ID: 1187603386

View in Genome Browser
Species Human (GRCh38)
Location X:20858183-20858205
Sequence TGTGATACGTAGACTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187603382_1187603386 7 Left 1187603382 X:20858153-20858175 CCTCCAAAGACATTAGGAATTTT No data
Right 1187603386 X:20858183-20858205 TGTGATACGTAGACTGTGGATGG No data
1187603383_1187603386 4 Left 1187603383 X:20858156-20858178 CCAAAGACATTAGGAATTTTCAG No data
Right 1187603386 X:20858183-20858205 TGTGATACGTAGACTGTGGATGG No data
1187603381_1187603386 8 Left 1187603381 X:20858152-20858174 CCCTCCAAAGACATTAGGAATTT No data
Right 1187603386 X:20858183-20858205 TGTGATACGTAGACTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187603386 Original CRISPR TGTGATACGTAGACTGTGGA TGG Intergenic
No off target data available for this crispr