ID: 1187608936

View in Genome Browser
Species Human (GRCh38)
Location X:20919306-20919328
Sequence CTCTGCCCAAATTTAGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187608934_1187608936 8 Left 1187608934 X:20919275-20919297 CCAGCTTGTAGTAATTATAATGA No data
Right 1187608936 X:20919306-20919328 CTCTGCCCAAATTTAGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187608936 Original CRISPR CTCTGCCCAAATTTAGTGTC AGG Intergenic
No off target data available for this crispr