ID: 1187617242

View in Genome Browser
Species Human (GRCh38)
Location X:21010193-21010215
Sequence CTGGCAAAACAGATTCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187617239_1187617242 10 Left 1187617239 X:21010160-21010182 CCACTGGGGCCACATTAATATTT No data
Right 1187617242 X:21010193-21010215 CTGGCAAAACAGATTCACCAAGG No data
1187617240_1187617242 1 Left 1187617240 X:21010169-21010191 CCACATTAATATTTGAACATCAT No data
Right 1187617242 X:21010193-21010215 CTGGCAAAACAGATTCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187617242 Original CRISPR CTGGCAAAACAGATTCACCA AGG Intergenic
No off target data available for this crispr