ID: 1187619443

View in Genome Browser
Species Human (GRCh38)
Location X:21034376-21034398
Sequence TCAAATATGCTCCTACTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187619443_1187619444 -7 Left 1187619443 X:21034376-21034398 CCAAGAAGTAGGAGCATATTTGA No data
Right 1187619444 X:21034392-21034414 TATTTGATATACTTAAATAATGG No data
1187619443_1187619445 -2 Left 1187619443 X:21034376-21034398 CCAAGAAGTAGGAGCATATTTGA No data
Right 1187619445 X:21034397-21034419 GATATACTTAAATAATGGTGAGG No data
1187619443_1187619450 27 Left 1187619443 X:21034376-21034398 CCAAGAAGTAGGAGCATATTTGA No data
Right 1187619450 X:21034426-21034448 GTGTGGCTGAAGTCCAGAAGGGG No data
1187619443_1187619448 25 Left 1187619443 X:21034376-21034398 CCAAGAAGTAGGAGCATATTTGA No data
Right 1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG No data
1187619443_1187619446 10 Left 1187619443 X:21034376-21034398 CCAAGAAGTAGGAGCATATTTGA No data
Right 1187619446 X:21034409-21034431 TAATGGTGAGGACGCCAGTGTGG No data
1187619443_1187619449 26 Left 1187619443 X:21034376-21034398 CCAAGAAGTAGGAGCATATTTGA No data
Right 1187619449 X:21034425-21034447 AGTGTGGCTGAAGTCCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187619443 Original CRISPR TCAAATATGCTCCTACTTCT TGG (reversed) Intergenic
No off target data available for this crispr