ID: 1187619448

View in Genome Browser
Species Human (GRCh38)
Location X:21034424-21034446
Sequence CAGTGTGGCTGAAGTCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187619443_1187619448 25 Left 1187619443 X:21034376-21034398 CCAAGAAGTAGGAGCATATTTGA No data
Right 1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187619448 Original CRISPR CAGTGTGGCTGAAGTCCAGA AGG Intergenic
No off target data available for this crispr