ID: 1187619469

View in Genome Browser
Species Human (GRCh38)
Location X:21034658-21034680
Sequence CAGGGTGAAAAAATGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187619469_1187619481 7 Left 1187619469 X:21034658-21034680 CCCACCCCCATTTTTTCACCCTG No data
Right 1187619481 X:21034688-21034710 AAAAAAAGGACAAAGACTTGAGG No data
1187619469_1187619476 -7 Left 1187619469 X:21034658-21034680 CCCACCCCCATTTTTTCACCCTG No data
Right 1187619476 X:21034674-21034696 CACCCTGCCCAAGGAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187619469 Original CRISPR CAGGGTGAAAAAATGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr