ID: 1187619876

View in Genome Browser
Species Human (GRCh38)
Location X:21040323-21040345
Sequence CATGGTCATAAATTTAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187619876_1187619881 6 Left 1187619876 X:21040323-21040345 CCCATTTTAAATTTATGACCATG No data
Right 1187619881 X:21040352-21040374 ATGTGGACCTTCAGTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187619876 Original CRISPR CATGGTCATAAATTTAAAAT GGG (reversed) Intergenic
No off target data available for this crispr