ID: 1187625729

View in Genome Browser
Species Human (GRCh38)
Location X:21111288-21111310
Sequence GTCACGCCACTCTTCACTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187625729_1187625732 3 Left 1187625729 X:21111288-21111310 CCAACAGTGAAGAGTGGCGTGAC No data
Right 1187625732 X:21111314-21111336 CCAAAGCAAGAAATAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187625729 Original CRISPR GTCACGCCACTCTTCACTGT TGG (reversed) Intergenic