ID: 1187625732 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:21111314-21111336 |
| Sequence | CCAAAGCAAGAAATAGAAGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 439 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 29, 4: 408} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187625729_1187625732 | 3 | Left | 1187625729 | X:21111288-21111310 | CCAACAGTGAAGAGTGGCGTGAC | No data | ||
| Right | 1187625732 | X:21111314-21111336 | CCAAAGCAAGAAATAGAAGTTGG | 0: 1 1: 0 2: 1 3: 29 4: 408 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187625732 | Original CRISPR | CCAAAGCAAGAAATAGAAGT TGG | Intergenic | ||