ID: 1187628280

View in Genome Browser
Species Human (GRCh38)
Location X:21141438-21141460
Sequence TAGGTCCTAGAGCCTTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187628269_1187628280 19 Left 1187628269 X:21141396-21141418 CCAGGTGGCTCGCTCAGGTGCCA No data
Right 1187628280 X:21141438-21141460 TAGGTCCTAGAGCCTTTGGGTGG No data
1187628276_1187628280 -1 Left 1187628276 X:21141416-21141438 CCAGCAGTTGCTAGGGGGTGGGT No data
Right 1187628280 X:21141438-21141460 TAGGTCCTAGAGCCTTTGGGTGG No data
1187628268_1187628280 22 Left 1187628268 X:21141393-21141415 CCTCCAGGTGGCTCGCTCAGGTG No data
Right 1187628280 X:21141438-21141460 TAGGTCCTAGAGCCTTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187628280 Original CRISPR TAGGTCCTAGAGCCTTTGGG TGG Intergenic
No off target data available for this crispr