ID: 1187631451

View in Genome Browser
Species Human (GRCh38)
Location X:21177345-21177367
Sequence TATCACTACAAAACACAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187631447_1187631451 -6 Left 1187631447 X:21177328-21177350 CCCAGTGCCAGATTCTGTATCAC No data
Right 1187631451 X:21177345-21177367 TATCACTACAAAACACAGGTTGG No data
1187631443_1187631451 6 Left 1187631443 X:21177316-21177338 CCCCCATGGAAACCCAGTGCCAG No data
Right 1187631451 X:21177345-21177367 TATCACTACAAAACACAGGTTGG No data
1187631444_1187631451 5 Left 1187631444 X:21177317-21177339 CCCCATGGAAACCCAGTGCCAGA No data
Right 1187631451 X:21177345-21177367 TATCACTACAAAACACAGGTTGG No data
1187631448_1187631451 -7 Left 1187631448 X:21177329-21177351 CCAGTGCCAGATTCTGTATCACT No data
Right 1187631451 X:21177345-21177367 TATCACTACAAAACACAGGTTGG No data
1187631445_1187631451 4 Left 1187631445 X:21177318-21177340 CCCATGGAAACCCAGTGCCAGAT No data
Right 1187631451 X:21177345-21177367 TATCACTACAAAACACAGGTTGG No data
1187631446_1187631451 3 Left 1187631446 X:21177319-21177341 CCATGGAAACCCAGTGCCAGATT No data
Right 1187631451 X:21177345-21177367 TATCACTACAAAACACAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187631451 Original CRISPR TATCACTACAAAACACAGGT TGG Intergenic
No off target data available for this crispr