ID: 1187633170

View in Genome Browser
Species Human (GRCh38)
Location X:21197423-21197445
Sequence TGGATCATTCATGAATGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187633170_1187633178 20 Left 1187633170 X:21197423-21197445 CCAAGCCATTCATGAATGATCCA No data
Right 1187633178 X:21197466-21197488 CCCATAAAGCCCCACCTCCTGGG No data
1187633170_1187633180 21 Left 1187633170 X:21197423-21197445 CCAAGCCATTCATGAATGATCCA No data
Right 1187633180 X:21197467-21197489 CCATAAAGCCCCACCTCCTGGGG No data
1187633170_1187633176 19 Left 1187633170 X:21197423-21197445 CCAAGCCATTCATGAATGATCCA No data
Right 1187633176 X:21197465-21197487 TCCCATAAAGCCCCACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187633170 Original CRISPR TGGATCATTCATGAATGGCT TGG (reversed) Intergenic
No off target data available for this crispr