ID: 1187633171

View in Genome Browser
Species Human (GRCh38)
Location X:21197428-21197450
Sequence GGGAGTGGATCATTCATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187633171_1187633185 29 Left 1187633171 X:21197428-21197450 CCATTCATGAATGATCCACTCCC No data
Right 1187633185 X:21197480-21197502 CCTCCTGGGGCTTCCAGTGTTGG No data
1187633171_1187633180 16 Left 1187633171 X:21197428-21197450 CCATTCATGAATGATCCACTCCC No data
Right 1187633180 X:21197467-21197489 CCATAAAGCCCCACCTCCTGGGG No data
1187633171_1187633176 14 Left 1187633171 X:21197428-21197450 CCATTCATGAATGATCCACTCCC No data
Right 1187633176 X:21197465-21197487 TCCCATAAAGCCCCACCTCCTGG No data
1187633171_1187633178 15 Left 1187633171 X:21197428-21197450 CCATTCATGAATGATCCACTCCC No data
Right 1187633178 X:21197466-21197488 CCCATAAAGCCCCACCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187633171 Original CRISPR GGGAGTGGATCATTCATGAA TGG (reversed) Intergenic
No off target data available for this crispr