ID: 1187633172

View in Genome Browser
Species Human (GRCh38)
Location X:21197443-21197465
Sequence AGGTGTTACAGTCATGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187633172_1187633189 21 Left 1187633172 X:21197443-21197465 CCACTCCCATGACTGTAACACCT No data
Right 1187633189 X:21197487-21197509 GGGCTTCCAGTGTTGGAGGTGGG No data
1187633172_1187633192 30 Left 1187633172 X:21197443-21197465 CCACTCCCATGACTGTAACACCT No data
Right 1187633192 X:21197496-21197518 GTGTTGGAGGTGGGGCCTTATGG 0: 4
1: 214
2: 1509
3: 3387
4: 4667
1187633172_1187633188 20 Left 1187633172 X:21197443-21197465 CCACTCCCATGACTGTAACACCT No data
Right 1187633188 X:21197486-21197508 GGGGCTTCCAGTGTTGGAGGTGG No data
1187633172_1187633178 0 Left 1187633172 X:21197443-21197465 CCACTCCCATGACTGTAACACCT No data
Right 1187633178 X:21197466-21197488 CCCATAAAGCCCCACCTCCTGGG No data
1187633172_1187633190 22 Left 1187633172 X:21197443-21197465 CCACTCCCATGACTGTAACACCT No data
Right 1187633190 X:21197488-21197510 GGCTTCCAGTGTTGGAGGTGGGG No data
1187633172_1187633187 17 Left 1187633172 X:21197443-21197465 CCACTCCCATGACTGTAACACCT No data
Right 1187633187 X:21197483-21197505 CCTGGGGCTTCCAGTGTTGGAGG No data
1187633172_1187633185 14 Left 1187633172 X:21197443-21197465 CCACTCCCATGACTGTAACACCT No data
Right 1187633185 X:21197480-21197502 CCTCCTGGGGCTTCCAGTGTTGG No data
1187633172_1187633176 -1 Left 1187633172 X:21197443-21197465 CCACTCCCATGACTGTAACACCT No data
Right 1187633176 X:21197465-21197487 TCCCATAAAGCCCCACCTCCTGG No data
1187633172_1187633180 1 Left 1187633172 X:21197443-21197465 CCACTCCCATGACTGTAACACCT No data
Right 1187633180 X:21197467-21197489 CCATAAAGCCCCACCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187633172 Original CRISPR AGGTGTTACAGTCATGGGAG TGG (reversed) Intergenic
No off target data available for this crispr