ID: 1187633174

View in Genome Browser
Species Human (GRCh38)
Location X:21197449-21197471
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187633174_1187633180 -5 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633180 X:21197467-21197489 CCATAAAGCCCCACCTCCTGGGG No data
1187633174_1187633192 24 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633192 X:21197496-21197518 GTGTTGGAGGTGGGGCCTTATGG No data
1187633174_1187633190 16 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633190 X:21197488-21197510 GGCTTCCAGTGTTGGAGGTGGGG No data
1187633174_1187633188 14 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633188 X:21197486-21197508 GGGGCTTCCAGTGTTGGAGGTGG No data
1187633174_1187633176 -7 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633176 X:21197465-21197487 TCCCATAAAGCCCCACCTCCTGG No data
1187633174_1187633193 25 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633193 X:21197497-21197519 TGTTGGAGGTGGGGCCTTATGGG No data
1187633174_1187633187 11 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633187 X:21197483-21197505 CCTGGGGCTTCCAGTGTTGGAGG No data
1187633174_1187633189 15 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633189 X:21197487-21197509 GGGCTTCCAGTGTTGGAGGTGGG No data
1187633174_1187633185 8 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633185 X:21197480-21197502 CCTCCTGGGGCTTCCAGTGTTGG No data
1187633174_1187633178 -6 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633178 X:21197466-21197488 CCCATAAAGCCCCACCTCCTGGG No data
1187633174_1187633194 28 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633194 X:21197500-21197522 TGGAGGTGGGGCCTTATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187633174 Original CRISPR TATGGGAGGTGTTACAGTCA TGG (reversed) Intergenic