ID: 1187633180

View in Genome Browser
Species Human (GRCh38)
Location X:21197467-21197489
Sequence CCATAAAGCCCCACCTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187633174_1187633180 -5 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633180 X:21197467-21197489 CCATAAAGCCCCACCTCCTGGGG No data
1187633173_1187633180 -4 Left 1187633173 X:21197448-21197470 CCCATGACTGTAACACCTCCCAT No data
Right 1187633180 X:21197467-21197489 CCATAAAGCCCCACCTCCTGGGG No data
1187633171_1187633180 16 Left 1187633171 X:21197428-21197450 CCATTCATGAATGATCCACTCCC No data
Right 1187633180 X:21197467-21197489 CCATAAAGCCCCACCTCCTGGGG No data
1187633172_1187633180 1 Left 1187633172 X:21197443-21197465 CCACTCCCATGACTGTAACACCT No data
Right 1187633180 X:21197467-21197489 CCATAAAGCCCCACCTCCTGGGG No data
1187633170_1187633180 21 Left 1187633170 X:21197423-21197445 CCAAGCCATTCATGAATGATCCA No data
Right 1187633180 X:21197467-21197489 CCATAAAGCCCCACCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187633180 Original CRISPR CCATAAAGCCCCACCTCCTG GGG Intergenic