ID: 1187633185

View in Genome Browser
Species Human (GRCh38)
Location X:21197480-21197502
Sequence CCTCCTGGGGCTTCCAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187633174_1187633185 8 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633185 X:21197480-21197502 CCTCCTGGGGCTTCCAGTGTTGG No data
1187633177_1187633185 -9 Left 1187633177 X:21197466-21197488 CCCATAAAGCCCCACCTCCTGGG No data
Right 1187633185 X:21197480-21197502 CCTCCTGGGGCTTCCAGTGTTGG No data
1187633179_1187633185 -10 Left 1187633179 X:21197467-21197489 CCATAAAGCCCCACCTCCTGGGG No data
Right 1187633185 X:21197480-21197502 CCTCCTGGGGCTTCCAGTGTTGG No data
1187633175_1187633185 -6 Left 1187633175 X:21197463-21197485 CCTCCCATAAAGCCCCACCTCCT No data
Right 1187633185 X:21197480-21197502 CCTCCTGGGGCTTCCAGTGTTGG No data
1187633173_1187633185 9 Left 1187633173 X:21197448-21197470 CCCATGACTGTAACACCTCCCAT No data
Right 1187633185 X:21197480-21197502 CCTCCTGGGGCTTCCAGTGTTGG No data
1187633172_1187633185 14 Left 1187633172 X:21197443-21197465 CCACTCCCATGACTGTAACACCT No data
Right 1187633185 X:21197480-21197502 CCTCCTGGGGCTTCCAGTGTTGG No data
1187633171_1187633185 29 Left 1187633171 X:21197428-21197450 CCATTCATGAATGATCCACTCCC No data
Right 1187633185 X:21197480-21197502 CCTCCTGGGGCTTCCAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187633185 Original CRISPR CCTCCTGGGGCTTCCAGTGT TGG Intergenic