ID: 1187633193

View in Genome Browser
Species Human (GRCh38)
Location X:21197497-21197519
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187633181_1187633193 -1 Left 1187633181 X:21197475-21197497 CCCCACCTCCTGGGGCTTCCAGT No data
Right 1187633193 X:21197497-21197519 TGTTGGAGGTGGGGCCTTATGGG No data
1187633175_1187633193 11 Left 1187633175 X:21197463-21197485 CCTCCCATAAAGCCCCACCTCCT No data
Right 1187633193 X:21197497-21197519 TGTTGGAGGTGGGGCCTTATGGG No data
1187633184_1187633193 -6 Left 1187633184 X:21197480-21197502 CCTCCTGGGGCTTCCAGTGTTGG No data
Right 1187633193 X:21197497-21197519 TGTTGGAGGTGGGGCCTTATGGG No data
1187633182_1187633193 -2 Left 1187633182 X:21197476-21197498 CCCACCTCCTGGGGCTTCCAGTG No data
Right 1187633193 X:21197497-21197519 TGTTGGAGGTGGGGCCTTATGGG No data
1187633179_1187633193 7 Left 1187633179 X:21197467-21197489 CCATAAAGCCCCACCTCCTGGGG No data
Right 1187633193 X:21197497-21197519 TGTTGGAGGTGGGGCCTTATGGG No data
1187633177_1187633193 8 Left 1187633177 X:21197466-21197488 CCCATAAAGCCCCACCTCCTGGG No data
Right 1187633193 X:21197497-21197519 TGTTGGAGGTGGGGCCTTATGGG No data
1187633173_1187633193 26 Left 1187633173 X:21197448-21197470 CCCATGACTGTAACACCTCCCAT No data
Right 1187633193 X:21197497-21197519 TGTTGGAGGTGGGGCCTTATGGG No data
1187633183_1187633193 -3 Left 1187633183 X:21197477-21197499 CCACCTCCTGGGGCTTCCAGTGT No data
Right 1187633193 X:21197497-21197519 TGTTGGAGGTGGGGCCTTATGGG No data
1187633186_1187633193 -9 Left 1187633186 X:21197483-21197505 CCTGGGGCTTCCAGTGTTGGAGG No data
Right 1187633193 X:21197497-21197519 TGTTGGAGGTGGGGCCTTATGGG No data
1187633174_1187633193 25 Left 1187633174 X:21197449-21197471 CCATGACTGTAACACCTCCCATA No data
Right 1187633193 X:21197497-21197519 TGTTGGAGGTGGGGCCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187633193 Original CRISPR TGTTGGAGGTGGGGCCTTAT GGG Intergenic