ID: 1187636677

View in Genome Browser
Species Human (GRCh38)
Location X:21237417-21237439
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187636668_1187636677 28 Left 1187636668 X:21237366-21237388 CCAGTAACAGCTGCATGGCGCAG No data
Right 1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187636677 Original CRISPR AGGGAGAACATAGTGACTGT GGG Intergenic
No off target data available for this crispr