ID: 1187636880

View in Genome Browser
Species Human (GRCh38)
Location X:21238711-21238733
Sequence AAGGGGAAGGAGGAGTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187636863_1187636880 30 Left 1187636863 X:21238658-21238680 CCTATGAGTCTGTGGTGGTGGTG No data
Right 1187636880 X:21238711-21238733 AAGGGGAAGGAGGAGTGGGAAGG No data
1187636870_1187636880 6 Left 1187636870 X:21238682-21238704 CCATGGGGAGAGGGTCCTTTGCC No data
Right 1187636880 X:21238711-21238733 AAGGGGAAGGAGGAGTGGGAAGG No data
1187636874_1187636880 -9 Left 1187636874 X:21238697-21238719 CCTTTGCCTAGAGAAAGGGGAAG No data
Right 1187636880 X:21238711-21238733 AAGGGGAAGGAGGAGTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187636880 Original CRISPR AAGGGGAAGGAGGAGTGGGA AGG Intergenic
No off target data available for this crispr