ID: 1187637423

View in Genome Browser
Species Human (GRCh38)
Location X:21245708-21245730
Sequence CTAAATACCCCACTTAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187637421_1187637423 -6 Left 1187637421 X:21245691-21245713 CCTTGAACAGAAACAGCCTAAAT No data
Right 1187637423 X:21245708-21245730 CTAAATACCCCACTTAAAATTGG No data
1187637420_1187637423 24 Left 1187637420 X:21245661-21245683 CCAGGATAATATCTCACATATCA No data
Right 1187637423 X:21245708-21245730 CTAAATACCCCACTTAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187637423 Original CRISPR CTAAATACCCCACTTAAAAT TGG Intergenic
No off target data available for this crispr