ID: 1187640561

View in Genome Browser
Species Human (GRCh38)
Location X:21284263-21284285
Sequence TGTCCTTGGCAGGACGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187640556_1187640561 16 Left 1187640556 X:21284224-21284246 CCATGGAATACTATGCAGTCATG No data
Right 1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187640561 Original CRISPR TGTCCTTGGCAGGACGTGGA TGG Intergenic
No off target data available for this crispr