ID: 1187643113

View in Genome Browser
Species Human (GRCh38)
Location X:21316456-21316478
Sequence AAATGATGGTAGAAAGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187643109_1187643113 -3 Left 1187643109 X:21316436-21316458 CCCAGGACTTCAAGAACTATAAA No data
Right 1187643113 X:21316456-21316478 AAATGATGGTAGAAAGATGGTGG No data
1187643110_1187643113 -4 Left 1187643110 X:21316437-21316459 CCAGGACTTCAAGAACTATAAAT No data
Right 1187643113 X:21316456-21316478 AAATGATGGTAGAAAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187643113 Original CRISPR AAATGATGGTAGAAAGATGG TGG Intergenic
No off target data available for this crispr