ID: 1187645970

View in Genome Browser
Species Human (GRCh38)
Location X:21347923-21347945
Sequence AAGCTAAGCATACTCTAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187645970_1187645972 4 Left 1187645970 X:21347923-21347945 CCTATTTAGAGTATGCTTAGCTT No data
Right 1187645972 X:21347950-21347972 AATCTGTAGGCTTATTTCTGTGG No data
1187645970_1187645971 -9 Left 1187645970 X:21347923-21347945 CCTATTTAGAGTATGCTTAGCTT No data
Right 1187645971 X:21347937-21347959 GCTTAGCTTCTTGAATCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187645970 Original CRISPR AAGCTAAGCATACTCTAAAT AGG (reversed) Intergenic
No off target data available for this crispr