ID: 1187648291

View in Genome Browser
Species Human (GRCh38)
Location X:21374025-21374047
Sequence GGTGGCGGCCACGGCGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187648291_1187648300 -5 Left 1187648291 X:21374025-21374047 CCCGTCCCGCCGTGGCCGCCACC No data
Right 1187648300 X:21374043-21374065 CCACCGCCGGGTCCCCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187648291 Original CRISPR GGTGGCGGCCACGGCGGGAC GGG (reversed) Intergenic
No off target data available for this crispr