ID: 1187648324

View in Genome Browser
Species Human (GRCh38)
Location X:21374143-21374165
Sequence GTGCGCGTGCGCGGCGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187648324_1187648328 -2 Left 1187648324 X:21374143-21374165 CCTCCGCCGCCGCGCACGCGCAC No data
Right 1187648328 X:21374164-21374186 ACTTCGCGCGCCTCTGTTCCCGG No data
1187648324_1187648329 2 Left 1187648324 X:21374143-21374165 CCTCCGCCGCCGCGCACGCGCAC No data
Right 1187648329 X:21374168-21374190 CGCGCGCCTCTGTTCCCGGACGG No data
1187648324_1187648331 14 Left 1187648324 X:21374143-21374165 CCTCCGCCGCCGCGCACGCGCAC No data
Right 1187648331 X:21374180-21374202 TTCCCGGACGGCCCCCAGAGCGG No data
1187648324_1187648332 15 Left 1187648324 X:21374143-21374165 CCTCCGCCGCCGCGCACGCGCAC No data
Right 1187648332 X:21374181-21374203 TCCCGGACGGCCCCCAGAGCGGG No data
1187648324_1187648335 24 Left 1187648324 X:21374143-21374165 CCTCCGCCGCCGCGCACGCGCAC No data
Right 1187648335 X:21374190-21374212 GCCCCCAGAGCGGGAACGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187648324 Original CRISPR GTGCGCGTGCGCGGCGGCGG AGG (reversed) Intergenic