ID: 1187649497

View in Genome Browser
Species Human (GRCh38)
Location X:21386481-21386503
Sequence CCATTTTACAAGCACTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187649497 Original CRISPR CCATTTTACAAGCACTCCAT TGG (reversed) Intronic
901879966 1:12188040-12188062 CCATTTTTGAAGCACTGCCTAGG - Intronic
907777439 1:57531717-57531739 AAATTTTACCAGCACACCATTGG - Intronic
908556883 1:65265397-65265419 TCTTTTTAGAAGCGCTCCATGGG + Intronic
909186526 1:72493549-72493571 CCTTTCTACAAGCACACCAAAGG - Intergenic
909761288 1:79290585-79290607 CAAGTTTAGAATCACTCCATTGG - Intergenic
910306159 1:85766439-85766461 TCATTTTAAAAACAGTCCATAGG + Intronic
910370182 1:86507145-86507167 CCATTTTACAATCATGACATAGG - Intergenic
911107230 1:94143436-94143458 GCATTTGAGAAGCACTCCAGAGG + Intergenic
912559075 1:110537426-110537448 CCATTATGCCAGGACTCCATGGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
917440669 1:175066338-175066360 CCATTTTCCATGCCCTCAATAGG - Intergenic
923916963 1:238518105-238518127 GCATTTTACAATCCCTCCAGGGG + Intergenic
1064869037 10:19916771-19916793 CCAGTTTTCAAGCACTGAATAGG - Intronic
1065498828 10:26358072-26358094 CCATTTTACAGCCATTACATTGG + Intergenic
1069101750 10:64330924-64330946 CTATTTTACAAACACCCTATAGG + Intergenic
1070471521 10:76785140-76785162 CCTTTTTACAAGCCCTACAGAGG - Intergenic
1071607638 10:87008493-87008515 CCCATTTGCAAGCAGTCCATGGG + Intergenic
1071675505 10:87651985-87652007 TGTTTTTACAAGCACTCCAGGGG + Intergenic
1074935522 10:118175984-118176006 TCAGTTTACCAGCACACCATTGG - Intergenic
1075513714 10:123093041-123093063 CCATTTTCCAGGCGCTCCAACGG + Intergenic
1076276743 10:129205934-129205956 CTATTTTACAAGCAAACCATTGG - Intergenic
1078002003 11:7504477-7504499 ACATTTTAAAAGCACGCCTTTGG + Intronic
1078140271 11:8687428-8687450 CCATATTACAAGTCCTCTATGGG - Exonic
1078290708 11:10007567-10007589 CCATTTTACAAGCCCAACAAAGG - Intronic
1078783049 11:14458294-14458316 CCATTTCACAAACACCCCATAGG + Intronic
1078864700 11:15286554-15286576 CCGTTTTACAAGAACCCCAAGGG + Intergenic
1079318953 11:19434034-19434056 CTATTTTGCACACACTCCATTGG + Intronic
1080729591 11:34935930-34935952 CTATTTTACAAGCACTAGACTGG - Intronic
1085016089 11:73174893-73174915 CCCTTTCACAAGCCCTACATAGG - Intergenic
1086662928 11:89444017-89444039 GCATTTTAAAAGCACTCAAAAGG + Intronic
1086959594 11:92969088-92969110 CCATTTTCCAAGCACTCGCTGGG - Intergenic
1092905557 12:13097741-13097763 CCATTTTACATGAATTCCCTGGG - Intronic
1095493702 12:42762549-42762571 TCATTTTACCAGCACACCACTGG + Intergenic
1097026892 12:56063412-56063434 CCAATTTACAAAAAATCCATAGG - Intergenic
1099191503 12:79565641-79565663 CCATTTTACAGGGAGCCCATTGG - Intergenic
1099948844 12:89277275-89277297 GCACTTGACAAGCACTTCATAGG + Intergenic
1102643337 12:114385752-114385774 CCCTTTTAAAAGCAGTCCAATGG - Intronic
1103126214 12:118424622-118424644 CCATTCAGCAAGCACTCAATGGG - Intergenic
1103326900 12:120127752-120127774 CCATCTTCCAAGCTCCCCATTGG + Exonic
1105910625 13:24862381-24862403 GCCTTGTACAAGCACTGCATTGG + Intronic
1115799354 14:36975001-36975023 CCATTTTTAAAGCACTCAGTAGG + Intronic
1116021894 14:39471284-39471306 AGATTTTACAATCACTCCCTTGG - Intergenic
1120672278 14:87376358-87376380 CCATTTTAGTAGCACTCAACTGG - Intergenic
1124506596 15:30281931-30281953 CCAGTCCGCAAGCACTCCATGGG - Intergenic
1124736961 15:32256705-32256727 CCAGTCCGCAAGCACTCCATGGG + Intergenic
1125486881 15:40117365-40117387 CCATTTCAGAATCACTCCAAAGG + Intergenic
1127453402 15:59137643-59137665 CCATTATTAAAGCAGTCCATGGG - Intronic
1127643191 15:60934366-60934388 TCTTTTTACAAGCCCTCCAGAGG - Intronic
1129157812 15:73729625-73729647 CCATTTTTCAAGTACTGAATGGG - Intergenic
1130888064 15:88110405-88110427 CCATCTTACAGGCAATCCACAGG + Intronic
1131089973 15:89616623-89616645 GCATTCTATAAGCTCTCCATGGG + Intronic
1131676483 15:94675310-94675332 CCATTTACCAAGGACTGCATTGG - Intergenic
1133992230 16:10717521-10717543 GAATTGTACAAGCCCTCCATAGG + Intergenic
1134107589 16:11494906-11494928 ACATTTTAAAAGCACCCCAGAGG + Intronic
1134616589 16:15656225-15656247 ACATTTTAAAAGCAATCCTTAGG - Intronic
1138027146 16:53531014-53531036 ACATTTTAACAGCACTCCACTGG + Intergenic
1139040029 16:62988621-62988643 TCATTTTACAAACACTTCTTAGG + Intergenic
1139345075 16:66297603-66297625 CCATTCTACAAGCCCTGCATCGG - Intergenic
1143374730 17:6460799-6460821 CCTTTTCACAAGCCCTCCAGGGG - Intronic
1144560172 17:16314888-16314910 CCATTTTTCCAGTTCTCCATGGG - Intronic
1146716703 17:35091950-35091972 CCATATTACAAGCAAATCATTGG + Intronic
1147208043 17:38852971-38852993 CCCTTTTAAAAGCACTCAATGGG - Intronic
1151283621 17:73094243-73094265 CCATATACCAAGCACTCCATGGG + Intergenic
1151421228 17:73999262-73999284 CCTTTTTACAACCATTCCCTAGG + Intergenic
1153199627 18:2635070-2635092 CCGTTTTACAACCATTTCATTGG - Intergenic
1153748224 18:8202258-8202280 CCATTTTCCCAGCCCTCCCTTGG + Intronic
1155645094 18:28068021-28068043 CCAGTGTAAAACCACTCCATAGG + Intronic
1157000561 18:43518497-43518519 ACATTTTACAACCACTGCATGGG - Intergenic
1157168632 18:45381877-45381899 CCATTTTACATGCAGTCCAGTGG + Intronic
1158901682 18:61967858-61967880 CCCTTCTAGAGGCACTCCATCGG + Intergenic
1159764516 18:72471700-72471722 CTAATTTACAAGCACTACACAGG + Intergenic
1162206354 19:9059054-9059076 CCATTTTACAAGCACTCCAGGGG + Intergenic
1163791078 19:19306411-19306433 CCAGTTTACAACCATTCCCTTGG + Intronic
1167758980 19:51431800-51431822 CCATTTTACATGCAGTGCAAAGG + Intergenic
926494546 2:13568712-13568734 CCATTTTACATGCACACCAATGG - Intergenic
931667937 2:64623612-64623634 CTGTGTTCCAAGCACTCCATGGG - Intergenic
931789048 2:65647080-65647102 GCATTTAACAAGAACTCCAGGGG + Intergenic
932378960 2:71264500-71264522 CCATTTTACAATCCCACCAGTGG + Intergenic
933417997 2:82011693-82011715 TCAGTTTACAACCACTCTATTGG - Intergenic
935018308 2:99205598-99205620 CCATTTTAGAGGCTCTCCCTGGG - Intronic
935422863 2:102887651-102887673 CCATATTACATACACTCCTTGGG + Intergenic
936262721 2:110975772-110975794 TAATTTTCCAAGCACTTCATGGG - Intronic
937402408 2:121595886-121595908 ACATATTAAAAGCACTACATGGG + Intronic
938681139 2:133691334-133691356 TCATTTGACAAGCCCTCCAGGGG - Intergenic
942495925 2:176539952-176539974 TCATATGACAAGCACACCATGGG - Intergenic
942657298 2:178227260-178227282 CCATTTTATAACCATTCAATTGG + Intronic
943514586 2:188868471-188868493 CCATTTTACAATCCCTCCAACGG - Intergenic
943520512 2:188944049-188944071 CCATTTTACAAGGACCTGATTGG + Intergenic
943814372 2:192233321-192233343 CCATTTCAATGGCACTCCATTGG - Intergenic
944279495 2:197878906-197878928 ACATTGTAAAAGCACTGCATGGG - Intronic
945703892 2:213204879-213204901 CCATTTTCCAAGGCCTCCATAGG + Intergenic
1169688629 20:8305506-8305528 CCATTTTGCAAACACACCTTGGG + Intronic
1170125336 20:12956858-12956880 GCATTTTATGAGGACTCCATTGG + Intergenic
1178495807 21:33085483-33085505 CCATTTTGCCAGCACACCGTTGG - Intergenic
949343308 3:3052447-3052469 GTATTTTACAAGCACCCCAATGG + Intronic
949568622 3:5269669-5269691 CCATGCTTCAAGCAGTCCATGGG - Intergenic
951845748 3:27082468-27082490 CCATTTTCCTAGAACTCTATTGG - Intergenic
953417270 3:42730246-42730268 CCATTCTACATGCACCCAATGGG - Intronic
953438320 3:42897315-42897337 CCATTTTACAAGCCCAACAAAGG - Intronic
953576352 3:44115953-44115975 CTATGTTACAGGCACTCCAGGGG + Intergenic
953857675 3:46513030-46513052 CCATTTTACAACCCCACCAACGG + Intergenic
955782306 3:62497987-62498009 CCATTCCACAAGCAGTCCACTGG + Intronic
958711992 3:97728272-97728294 CCATTTCCCAAGCACTCTCTGGG - Intronic
959784610 3:110279982-110280004 CCAATTTGAAAGTACTCCATTGG - Intergenic
961604584 3:128084136-128084158 ACATTTCACAAACACTGCATAGG + Intronic
964550389 3:157878758-157878780 CCATCCTACCAGCACTTCATGGG + Intergenic
970420972 4:15905596-15905618 CCATTTTATAAGCGCTTAATAGG + Intergenic
971568251 4:28173495-28173517 CTATATTCGAAGCACTCCATTGG + Intergenic
972105050 4:35473989-35474011 AGATTTTACATGCAGTCCATTGG - Intergenic
975942127 4:79660406-79660428 CCATGGTCCAAGCTCTCCATTGG - Intergenic
978948840 4:114531829-114531851 TCATTTTACAAGGCCTGCATCGG + Intergenic
981664500 4:147207748-147207770 CAATTTTTTAAGCACTCTATTGG + Intergenic
981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG + Intergenic
982419142 4:155173543-155173565 GCATTTTTAAAGCACTCCAGAGG + Intergenic
982596433 4:157391093-157391115 CCAATTTACCAGCACACCATTGG - Intergenic
983177709 4:164611046-164611068 CCATTTCACAAACACACCAAGGG - Intergenic
983756824 4:171349040-171349062 CCATGCTAAAAGCACTCAATGGG + Intergenic
983962524 4:173771989-173772011 TCACTTTACAGACACTCCATTGG + Intergenic
987377388 5:17248880-17248902 CCTTTGTACCACCACTCCATGGG + Intronic
987987004 5:25160963-25160985 CCCCCTTTCAAGCACTCCATAGG - Intergenic
988589159 5:32534005-32534027 CCATTTTACAAGAAATCAAGAGG + Intronic
988720215 5:33869938-33869960 CCATTTTAGAGGCCCTCCCTGGG + Intronic
991394306 5:66187622-66187644 CAATTTTAAAAGTACTACATGGG + Intergenic
992390806 5:76329069-76329091 CATTTTTACAAGCACTAAATAGG + Exonic
992500103 5:77333782-77333804 ACATTTTACAACCTGTCCATGGG + Intronic
992869384 5:80991130-80991152 GCATTTTACAAGGCCTCCAGGGG - Intronic
994463380 5:100095390-100095412 CCATTTTATAATCATTCTATTGG - Intergenic
994941704 5:106331552-106331574 CCATTTTACAATCCCACTATTGG + Intergenic
1005139391 6:22610528-22610550 CCATTTGGCAATCACTGCATGGG - Intergenic
1007287324 6:40757075-40757097 GCATTTTAGAAGCACCCCTTTGG + Intergenic
1011725861 6:90209983-90210005 CCTTTTTAAAAGAACTCCAAAGG - Intronic
1012408794 6:98932086-98932108 CCATTTTATAATCACTCTTTTGG - Intronic
1013333508 6:109130908-109130930 GCATCTTATAAGCACTCTATGGG + Intronic
1014766579 6:125413504-125413526 ACATTTCACAAGGACTTCATGGG - Intergenic
1017224334 6:152002588-152002610 CCATTTGACAAGCACTTAAAAGG + Intronic
1019763785 7:2834144-2834166 CCACATTACAACCACTCCTTTGG + Intronic
1031083203 7:117278106-117278128 CCCTTCTACAAGGACTCCATTGG - Exonic
1039591409 8:38752973-38752995 CCATTTTAGAACCACACCAAGGG + Intronic
1040324073 8:46332588-46332610 CCATTTTACACAGAGTCCATTGG - Intergenic
1041394329 8:57375850-57375872 CCATTTTACCACTACTCCAGTGG - Intergenic
1041468190 8:58179195-58179217 TCATTTTAAAAGCATTACATGGG - Intronic
1042218205 8:66448496-66448518 CCAGTTTACTAGCACACCACTGG - Intronic
1047771389 8:128032893-128032915 CTCTTTTGCTAGCACTCCATTGG + Intergenic
1048099173 8:131329265-131329287 ACCATTTACAAGCACTCCAAAGG + Intergenic
1050708845 9:8436186-8436208 CCCTTTTGCCAGCCCTCCATTGG - Intronic
1050851135 9:10287786-10287808 CCAATTTAGAAGCATTCCTTAGG + Intronic
1051289040 9:15527155-15527177 CTCTTTGACAAGCACTCCCTGGG - Intergenic
1052584630 9:30410897-30410919 TCATTCTACAAGGCCTCCATCGG - Intergenic
1055381990 9:75717429-75717451 CAATTTGTCAAGCACACCATAGG + Intergenic
1055732418 9:79292046-79292068 CTCTGTTACCAGCACTCCATGGG - Intergenic
1058544685 9:106048448-106048470 CCATTTTTTATGTACTCCATTGG - Intergenic
1059370924 9:113834487-113834509 CCAATTTAAAATAACTCCATAGG + Intergenic
1060735285 9:126062871-126062893 CCATGTTACTAGCATTCCACTGG - Intergenic
1187649497 X:21386481-21386503 CCATTTTACAAGCACTCCATTGG - Intronic
1188446236 X:30255926-30255948 CCATTTTAGAGGCCCCCCATGGG + Intergenic
1190570003 X:51770977-51770999 CCCTCTTTCAGGCACTCCATTGG + Intergenic
1193286733 X:79723205-79723227 CCATTTTACAAGTATGACATAGG - Intergenic
1195252257 X:103060657-103060679 TTATTTTACCTGCACTCCATAGG + Intergenic
1195745084 X:108109107-108109129 CCATTTTACAATCTCACCAGTGG + Intronic
1196651761 X:118175124-118175146 CCATTTTACAACACCTCCAGTGG - Intergenic
1197314337 X:124945930-124945952 GCATTTTACAAGCTCTTCAGAGG - Intronic
1197651613 X:129071618-129071640 CCAATTTACCAGCACACCACAGG + Intergenic
1198515430 X:137401769-137401791 CCAGTTTACCAGTACTCCACTGG - Intergenic
1198734312 X:139769693-139769715 CCATTTGACAACCACTACAGTGG + Intronic
1199544778 X:148996294-148996316 ACATTTTACCAGCACACCACTGG - Exonic