ID: 1187652331

View in Genome Browser
Species Human (GRCh38)
Location X:21422274-21422296
Sequence CAGGATCAGCAGCTACTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 231}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187652317_1187652331 29 Left 1187652317 X:21422222-21422244 CCTTTAGGAGCTCAGCCCCGCCT 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1187652331 X:21422274-21422296 CAGGATCAGCAGCTACTGCATGG 0: 1
1: 0
2: 0
3: 25
4: 231
1187652325_1187652331 2 Left 1187652325 X:21422249-21422271 CCATGGTGCCCAGCCATAGGTCC 0: 1
1: 0
2: 1
3: 23
4: 257
Right 1187652331 X:21422274-21422296 CAGGATCAGCAGCTACTGCATGG 0: 1
1: 0
2: 0
3: 25
4: 231
1187652324_1187652331 3 Left 1187652324 X:21422248-21422270 CCCATGGTGCCCAGCCATAGGTC 0: 1
1: 0
2: 1
3: 5
4: 81
Right 1187652331 X:21422274-21422296 CAGGATCAGCAGCTACTGCATGG 0: 1
1: 0
2: 0
3: 25
4: 231
1187652328_1187652331 -7 Left 1187652328 X:21422258-21422280 CCAGCCATAGGTCCAGCAGGATC 0: 1
1: 0
2: 0
3: 14
4: 109
Right 1187652331 X:21422274-21422296 CAGGATCAGCAGCTACTGCATGG 0: 1
1: 0
2: 0
3: 25
4: 231
1187652322_1187652331 9 Left 1187652322 X:21422242-21422264 CCTAATCCCATGGTGCCCAGCCA 0: 1
1: 0
2: 3
3: 92
4: 509
Right 1187652331 X:21422274-21422296 CAGGATCAGCAGCTACTGCATGG 0: 1
1: 0
2: 0
3: 25
4: 231
1187652319_1187652331 14 Left 1187652319 X:21422237-21422259 CCCCGCCTAATCCCATGGTGCCC 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1187652331 X:21422274-21422296 CAGGATCAGCAGCTACTGCATGG 0: 1
1: 0
2: 0
3: 25
4: 231
1187652327_1187652331 -6 Left 1187652327 X:21422257-21422279 CCCAGCCATAGGTCCAGCAGGAT 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1187652331 X:21422274-21422296 CAGGATCAGCAGCTACTGCATGG 0: 1
1: 0
2: 0
3: 25
4: 231
1187652320_1187652331 13 Left 1187652320 X:21422238-21422260 CCCGCCTAATCCCATGGTGCCCA 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1187652331 X:21422274-21422296 CAGGATCAGCAGCTACTGCATGG 0: 1
1: 0
2: 0
3: 25
4: 231
1187652321_1187652331 12 Left 1187652321 X:21422239-21422261 CCGCCTAATCCCATGGTGCCCAG 0: 1
1: 0
2: 2
3: 15
4: 154
Right 1187652331 X:21422274-21422296 CAGGATCAGCAGCTACTGCATGG 0: 1
1: 0
2: 0
3: 25
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187652331 Original CRISPR CAGGATCAGCAGCTACTGCA TGG Intronic
901401038 1:9015184-9015206 CAGGGTCAGCAGCTGCAGCAGGG + Exonic
901625802 1:10624367-10624389 CTGAATCAGCAGCTCCTGGACGG - Exonic
902234322 1:15047961-15047983 CAGCACCAGCAGCTACAGCCAGG - Intronic
905803069 1:40858040-40858062 CAGGATCAGCAGCTGCAGAAGGG - Intergenic
906540558 1:46582581-46582603 GAGGATCAGTAGCTACTCCTAGG - Intronic
906688766 1:47779141-47779163 CAGGCTCAGCACCTACTGGCTGG + Intronic
907871157 1:58444576-58444598 CACCATCAGCATTTACTGCAAGG + Intronic
909384872 1:75043050-75043072 AAGAAACAGCAGATACTGCAGGG + Intergenic
910599134 1:89011834-89011856 CAGGTCCAGCAGCTCCTGGAGGG + Exonic
910603503 1:89056941-89056963 CAGGTCCAGCAGCTCCTGGAGGG + Exonic
910608517 1:89114103-89114125 CAGGTCCAGCAGCTCCTGGAGGG + Exonic
910621908 1:89264773-89264795 CAGGTCCAGCAGCTCCTGGAGGG + Exonic
910637215 1:89422175-89422197 CAGGTCCAGCAGCTCCTGGAGGG - Intergenic
911352801 1:96774783-96774805 CATGAACAGGACCTACTGCATGG - Intronic
912344120 1:108948277-108948299 CAGGAACTGCAGCTTCTCCAGGG + Intronic
912561522 1:110555040-110555062 CTGGATCAGCAGCCCCCGCACGG + Intergenic
913088193 1:115458256-115458278 CAGGATGAGCAGCTATTGGGAGG + Intergenic
915929514 1:160050862-160050884 CAGGCCCTGCAGCTCCTGCAAGG + Intronic
920250539 1:204619627-204619649 CAGGCTCAGCAGCTGGGGCAGGG + Exonic
920590872 1:207217303-207217325 CAGCACCAGCAGCAACTGGAGGG + Intergenic
921156349 1:212441993-212442015 CAGGAACAGAAGCAACTTCATGG - Intronic
921503806 1:215941647-215941669 CAGGCTCAGCAGGTTCAGCATGG - Intronic
922419515 1:225450061-225450083 CTGGATCATCAGCTGCTGCGGGG - Intergenic
923697263 1:236265648-236265670 CAGGATAAGAAACTACTGAAGGG - Intronic
1063174350 10:3538190-3538212 CAGCAGCAGCAGCCTCTGCACGG + Intergenic
1064365504 10:14703879-14703901 CAGGTTCTGCAGCGACTGAAGGG + Intronic
1064569990 10:16682817-16682839 CAGGATCCACACCTACTGGAGGG + Intronic
1065806140 10:29395057-29395079 CAGGATTACCAGCTGCTGGAAGG + Intergenic
1065976457 10:30846746-30846768 CTGGATCTGCAGCCACAGCAGGG - Intronic
1067203785 10:44196614-44196636 CAGGAACAGCAACTCCAGCAAGG + Intergenic
1069219903 10:65870058-65870080 CAGGATAAATAGCTAATGCATGG + Intergenic
1071785806 10:88898510-88898532 CAGGACCATCAGCTAATACATGG + Intronic
1073103306 10:101018403-101018425 CAGGATCTGCAGCTACGCCGGGG + Intronic
1074427575 10:113365619-113365641 CAGGACCAGTAACTAATGCAGGG - Intergenic
1076547100 10:131252757-131252779 CAGGAGCAGCAGCTGCTTCCCGG - Intronic
1076849222 10:133084888-133084910 CAGCAACAGCAGCTCCTGCCTGG + Intronic
1076904935 10:133356964-133356986 CAGGGGCAGCAGCTTCAGCACGG + Exonic
1077302744 11:1854784-1854806 CAGGAGCAGCACCTAGTCCAGGG - Intronic
1077488532 11:2850069-2850091 CGGGAGCAGCAGTTACTGAAAGG + Intergenic
1078853927 11:15190914-15190936 GAGACTCAGCAGCTAATGCAGGG - Intronic
1079344147 11:19637321-19637343 CAAGATCAGCAGCTAGGGAAGGG - Intronic
1081083310 11:38769302-38769324 CATGCTCAGCAGCTGCAGCAGGG - Intergenic
1083213412 11:61203563-61203585 CAGCAGCAGCAGCCACTTCATGG - Exonic
1083216296 11:61222399-61222421 CAGCAGCAGCAGCCACTTCATGG - Exonic
1083219178 11:61241225-61241247 CAGCAGCAGCAGCCACTTCATGG - Exonic
1083367598 11:62150848-62150870 CCGGCTCAGCAACCACTGCAAGG - Intronic
1084593630 11:70104672-70104694 CTGGGTCAGCAGTGACTGCAAGG + Intronic
1085038135 11:73311658-73311680 CAGGTTCAGCATGTACTGCTTGG - Exonic
1088847776 11:113682289-113682311 CAGGCTCAGAAGCTACCACAGGG + Intergenic
1089672862 11:120068465-120068487 CTAGATCAGGAGCTACGGCACGG - Intergenic
1090470363 11:126975510-126975532 CTGGACTAGCAGCTACTGGAGGG - Intronic
1093098651 12:15000976-15000998 CATAATCTGCAGCTGCTGCATGG + Intergenic
1096491216 12:52014180-52014202 CAGGAGCAGCGGCTGGTGCATGG + Exonic
1099994633 12:89764831-89764853 CAGGATAAATAGCTAATGCATGG + Intergenic
1100617604 12:96242999-96243021 CAGAGGCAGCAGCTACTGAAGGG + Intronic
1102886829 12:116528521-116528543 CAGAATCCTCAGCCACTGCATGG - Intergenic
1103488684 12:121299382-121299404 CATGAACAGTATCTACTGCATGG - Intergenic
1104081103 12:125431126-125431148 TGGGATGAGCAGCTACTGCAGGG + Intronic
1104166006 12:126230253-126230275 TAGGATTGGAAGCTACTGCAGGG + Intergenic
1104247242 12:127055688-127055710 CAGCAGCAGCAGGCACTGCAGGG - Intergenic
1104259653 12:127171007-127171029 CAGGCTGAGCATCTTCTGCAAGG + Intergenic
1104570984 12:129925910-129925932 CAGGGACACCAGCTACAGCATGG + Intergenic
1104856602 12:131905134-131905156 CAGGATCCACAGACACTGCAGGG - Intronic
1104866960 12:131961451-131961473 CAGCAGCAGCAGGTGCTGCAGGG + Exonic
1104885509 12:132104819-132104841 CAGCAGCAGCAGGTGCTGCAGGG + Exonic
1105029891 12:132874831-132874853 CAGGACCAGCACCCAGTGCAGGG + Intronic
1105668301 13:22585317-22585339 CAAAATCATCAGATACTGCAAGG - Intergenic
1106229807 13:27813064-27813086 CAGGATCAGTAGCTATTGGAGGG + Intergenic
1107065727 13:36213035-36213057 CACAATCAGCAGCAGCTGCAGGG + Intronic
1107765609 13:43730937-43730959 AAAGAGCAGCAGCTGCTGCAGGG - Intronic
1108586639 13:51875714-51875736 CCTGATCAGCAGCGCCTGCAAGG - Intergenic
1108878089 13:55073245-55073267 CAGCATCAGCAAATACTGTAGGG - Intergenic
1109844957 13:67976663-67976685 CATGATCAATAGCTTCTGCAGGG - Intergenic
1112343439 13:98571206-98571228 CAGGGTGAGCAGTTACTGAAGGG - Intronic
1113848436 13:113404939-113404961 CAAGGTCAGCAGCATCTGCAGGG - Intergenic
1115522737 14:34249051-34249073 GAGGCTCACCATCTACTGCATGG + Intronic
1116113930 14:40624055-40624077 CAGAATAAGCAGCTACTTTAGGG - Intergenic
1116820374 14:49621208-49621230 AAGGAGCAGCTGCTTCTGCACGG - Exonic
1119611508 14:76067010-76067032 CTGGATCAGAAGCTCCTGAAGGG - Intronic
1120255514 14:82114340-82114362 CAGGAAGGGCTGCTACTGCATGG - Intergenic
1121633533 14:95438736-95438758 CACTAGCAGCAGCTCCTGCAGGG - Intronic
1121861591 14:97323975-97323997 CAGGAACAGCACCTACCACATGG - Intergenic
1122783162 14:104152247-104152269 CAGGACCAGCGGGTCCTGCAGGG + Exonic
1122853044 14:104547053-104547075 CTGGAGCAGCAGCTGCTGCCGGG - Intronic
1123670108 15:22647912-22647934 CAGGATAAATAGCTAGTGCATGG + Intergenic
1124010852 15:25837569-25837591 CAGCATCAACATCTACTACATGG - Intronic
1124181244 15:27477390-27477412 AAGGATCAGTAGTTGCTGCAGGG + Intronic
1124430460 15:29603296-29603318 CAGCATCAGCAGCATCTGCAGGG + Intergenic
1124515289 15:30362534-30362556 CACGATGAGCACCTCCTGCACGG - Exonic
1124526082 15:30454328-30454350 CAGGATAAATAGCTAGTGCATGG + Intergenic
1124727633 15:32168195-32168217 CACGATGAGCACCTCCTGCACGG + Exonic
1124772572 15:32553357-32553379 CAGGATAAATAGCTAGTGCATGG - Intergenic
1125540409 15:40466721-40466743 CAGCACCAGTTGCTACTGCAGGG - Exonic
1125721509 15:41847329-41847351 CAGGAGCTGCAACTGCTGCAGGG - Exonic
1127836999 15:62797980-62798002 GAGAAGCAGCAGCTGCTGCAGGG + Intronic
1127964325 15:63912441-63912463 GAGGCTCAGCAGCTCCTGAAGGG + Intronic
1129168017 15:73790043-73790065 CAGGGTCAGGAGCCACTGCATGG + Intergenic
1129465919 15:75724160-75724182 GAGCAGCAGCAGCTACAGCAGGG - Exonic
1132333725 15:101029966-101029988 CAACATCATCAGCTACTCCAGGG + Intronic
1132536318 16:482868-482890 GAAGGTCAGGAGCTACTGCAGGG - Intronic
1133093133 16:3420666-3420688 CAGGAACAGAAAATACTGCACGG - Intronic
1133344777 16:5062513-5062535 CAGGCTCAGCGGCTGCAGCAGGG + Exonic
1134843041 16:17416607-17416629 CAGGAGCCGCAGCTCCTCCAGGG - Intronic
1135777047 16:25266048-25266070 GAAGACCAGCAGCTACTACATGG - Intergenic
1137323035 16:47405591-47405613 GAGGTTCAGCAGCTTCTCCATGG - Intronic
1140805135 16:78526282-78526304 CAGGACCAGCAGCGCCTCCAAGG - Intronic
1142414789 16:89935456-89935478 CAAGAACAGCAGCTACTTCGTGG + Exonic
1143080066 17:4375093-4375115 CAGGGTCAGCAGCAACTTCCCGG - Intergenic
1143164384 17:4890643-4890665 CAGCAGCAGCAGCTCCTGCCTGG + Exonic
1143847363 17:9782737-9782759 CACCAACAGCACCTACTGCAGGG + Intronic
1143890285 17:10097522-10097544 CAGGTGCAGCAGCTCTTGCAGGG + Intronic
1145764902 17:27451893-27451915 CAGGAGCAGCAGCAACTGTATGG - Intergenic
1145998413 17:29117491-29117513 CAGGAGAAGCAGCTACTCCTGGG + Intronic
1150490611 17:65571918-65571940 CAGGATAAATAGCTAATGCATGG + Intronic
1151568617 17:74914953-74914975 CAGGAGCAGGAGCTGCTCCAGGG - Intergenic
1154030833 18:10752773-10752795 CAGGATCAGCATCTTTTGCATGG - Exonic
1156356791 18:36349011-36349033 CAGGCTCAGCAGCAACTTTAGGG - Intronic
1160322126 18:77905773-77905795 CAGGATCAGCCTCCCCTGCAGGG + Intergenic
1160426929 18:78784087-78784109 CAGTCTCAGCAGCTGCTGCCTGG + Intergenic
1161145411 19:2675291-2675313 CAGGAACAGCAGCAAGTGCACGG + Intronic
1161815179 19:6495472-6495494 CAAGAACAGCAGCTACTTCGTGG - Exonic
1163567878 19:18062358-18062380 CAGGATCAGCAGCAAGTTCATGG - Intronic
1165138756 19:33686931-33686953 CGGGAGCAGCTGCTATTGCACGG - Intronic
1165394210 19:35555458-35555480 CACGATCACCAGCTTCTGCTGGG + Exonic
1165695895 19:37900788-37900810 CAGAATGAGCAGCAAGTGCAGGG - Intronic
925637799 2:5959120-5959142 CAGGTTCATCATCTCCTGCAGGG + Intergenic
926217274 2:10913289-10913311 CATGATCCGCAGCGCCTGCACGG - Exonic
926334837 2:11855363-11855385 GAGGAGAGGCAGCTACTGCAGGG + Intergenic
926437126 2:12849545-12849567 CAGGTACAGCACCTGCTGCATGG - Intergenic
929946835 2:46378066-46378088 CAGCAGCAGCAGCTGCTCCACGG + Exonic
931319245 2:61159989-61160011 CATGGTTAGCAGGTACTGCAGGG - Intronic
931901209 2:66790286-66790308 CAGGATCAGGAGGTCCTTCAGGG - Intergenic
932682242 2:73836319-73836341 CAGGAGCAGCAGCTGTTGCAGGG + Intronic
934674448 2:96239702-96239724 CAGGTTCAGCACCTACAGAAGGG - Intergenic
939982363 2:148796842-148796864 CAGGAAAAGCAGCTTCTGAAGGG - Intergenic
940153507 2:150628892-150628914 CAGGTTCAGCAGGTCCTGCTTGG - Intergenic
941654646 2:168130165-168130187 CAAGAGCAGCAGGTACTGCAAGG + Intronic
941850910 2:170179094-170179116 CAGGATAAATAGCTAATGCATGG + Intronic
942328550 2:174796596-174796618 CAGAATGAGCATCAACTGCATGG + Intergenic
943027516 2:182647565-182647587 GATAATCAGCAGCTTCTGCAGGG + Intergenic
946262800 2:218509979-218510001 CACCAACAGCAGCAACTGCAGGG - Exonic
946337819 2:219050075-219050097 CAGGCTCAGCAGATTCTGCCAGG - Intergenic
946588461 2:221216963-221216985 GAGGATCAGCAGCTTCTGACAGG + Intergenic
947409282 2:229818485-229818507 AAGGCCCAGCAGCTACTACAAGG - Exonic
948464609 2:238146160-238146182 CAGCACCTGCAGCTACAGCAAGG + Intronic
1174160195 20:48545173-48545195 CAGGATTAGCAGATGCTGGAAGG - Intergenic
1175654418 20:60756110-60756132 CAGGCCCAGCAGGTACAGCAAGG - Intergenic
1176143936 20:63557184-63557206 CAGGATCAGCTGCTTTTGCTAGG + Intergenic
1176373297 21:6075184-6075206 CAGGGTCAGCAGGTCCTGGAGGG + Intergenic
1179750180 21:43463059-43463081 CAGGGTCAGCAGGTCCTGGAGGG - Intergenic
1181126407 22:20704303-20704325 CAGCGTCAGCAGCGCCTGCAGGG - Intergenic
1181512868 22:23396564-23396586 CAGGTTCAGCAGCCCCTACAGGG + Intergenic
1182424333 22:30264182-30264204 CAGGAACAACATCTACTGCATGG - Exonic
1182941846 22:34284259-34284281 AAAGATCAGAAGCTGCTGCATGG + Intergenic
1184110521 22:42391309-42391331 CAGGATCATTGGCTACTGCCAGG + Intronic
1185370305 22:50457794-50457816 CAGGCTCACCTGCTTCTGCAAGG + Intronic
950673071 3:14538845-14538867 CAGGGTCAGCATCAACTGCCTGG - Intronic
951359147 3:21703829-21703851 CAGGAGTAGCAGCTATTGCTAGG - Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
954783770 3:53078715-53078737 CAGGATCTGGAGCTGCTGCCTGG - Intronic
954913438 3:54128641-54128663 CATGAGCAGCAGCTACTTCAGGG + Intronic
956267878 3:67418050-67418072 CAGAATCAGAACCTACTGCATGG - Intronic
956267908 3:67418411-67418433 CAAGATCAGCAGCTAATTAATGG + Intronic
956687721 3:71846402-71846424 GAGGCTCAGCAGCTGCTGAAAGG - Intergenic
956858115 3:73295765-73295787 CAGAATCAGTAGTTACAGCAGGG + Intergenic
957594112 3:82238926-82238948 CAACATCAGCAGCCACTCCAAGG - Intergenic
958996747 3:100914473-100914495 TAGGAACAGCAGCCACTGCTGGG + Intronic
960384616 3:117007136-117007158 CAGGATAAATAGCTAATGCATGG - Intronic
960688142 3:120314197-120314219 CATGCTCATCAGCTACAGCAGGG - Intergenic
962390897 3:134971697-134971719 CAGGATCTGCTGCATCTGCAGGG - Intronic
962626017 3:137226888-137226910 CAGGATCAGCAGCCTGTGCTAGG - Intergenic
962713045 3:138103495-138103517 CTGCATTAGCAGCTGCTGCAGGG + Exonic
962908889 3:139829737-139829759 CCAGATCATCAGCTTCTGCAGGG + Intergenic
967875014 3:194262644-194262666 TACGAGAAGCAGCTACTGCAAGG + Intergenic
968276834 3:197446617-197446639 CAGGATCAGCAGCACCAGCATGG + Intergenic
968377711 4:57381-57403 CAGGATCTGCAGCTCCATCAGGG + Intronic
968401130 4:298704-298726 CAGGATCTGCAGCTTCACCAGGG - Intronic
969872698 4:10114879-10114901 GAGGAACAGCAGCGACTGCCTGG + Intronic
972644207 4:40952806-40952828 CAGTAACAGCAACAACTGCAAGG + Intronic
973000045 4:44936547-44936569 CAGGATGAGAACCTAGTGCAGGG - Intergenic
975405818 4:73988026-73988048 CAGAAGCAGCAGCACCTGCAAGG + Exonic
975603065 4:76123813-76123835 CAGAATAAGAAGATACTGCATGG - Intronic
978128693 4:105167688-105167710 CAGGATGAACTGCTACTGCTAGG - Intronic
979727785 4:123985064-123985086 CATCATCAGCAGCTGCTGCAGGG + Intergenic
982028547 4:151276627-151276649 CAGGATCAGCAGCTCTTGGGTGG - Intronic
984623105 4:181975644-181975666 CTGGTTAGGCAGCTACTGCAGGG + Intergenic
985655934 5:1131352-1131374 CAGCCTCAGCAGCTGCTGAAGGG + Intergenic
985695509 5:1337943-1337965 CAGGATGGGCAGGTAATGCACGG + Exonic
988127828 5:27064323-27064345 CAGAATCAGAATCGACTGCATGG + Intronic
990086257 5:51981837-51981859 CAGGATAAGCAACTACTTAATGG + Intergenic
991014747 5:61918783-61918805 CAGGTTCAGCTCCTACTTCAAGG + Intergenic
992502338 5:77355224-77355246 TAGGAGCAGCAGCTAATTCATGG - Intronic
995114265 5:108461318-108461340 CAGGAACAGCAATGACTGCAAGG - Intergenic
995896168 5:117013609-117013631 CACGCTCATCAGCTGCTGCAGGG + Intergenic
996916100 5:128713857-128713879 CAGGATCTCCAGCTACTACATGG + Intronic
998041168 5:138951824-138951846 GATGACCAGCAGCTTCTGCAGGG + Exonic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
1000906010 5:166966485-166966507 CTGGATCAGCAGTGACTGCGTGG - Intergenic
1002797481 6:486367-486389 CAGGAAGAGCTGCTTCTGCAGGG - Exonic
1002839269 6:892252-892274 CAATATCAGCAGCATCTGCATGG - Intergenic
1003097460 6:3154174-3154196 CAAGAACAGCAGCTACTTCGTGG - Exonic
1003107000 6:3225062-3225084 CAAGAACAGCAGCTACTTCGTGG - Exonic
1004004788 6:11628649-11628671 CAGCAGCAGCAGCTACAGGAAGG - Intergenic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1007938790 6:45757539-45757561 CAAGATCAGCAGCTCAAGCATGG + Intergenic
1008827456 6:55714588-55714610 CAGAATGAGCAGCAAGTGCAAGG + Intergenic
1009581335 6:65537874-65537896 CAGCATCAGCACTTACTGCAGGG - Intronic
1010984935 6:82412854-82412876 CAGGAGCCTCAGCTACTGCAGGG + Intergenic
1011080517 6:83485783-83485805 CAGGATAAATAGCTAATGCATGG + Intergenic
1011628555 6:89302768-89302790 CAAGAACAGCAGCTACTTCGTGG + Intronic
1011702909 6:89972104-89972126 CAGGAGCAGCAGCTGGGGCAAGG + Intronic
1012036426 6:94146951-94146973 TAGGATAAGCATCTTCTGCAAGG - Intergenic
1012600542 6:101091872-101091894 CAAGATCAGCATCAACTGCTTGG - Intergenic
1014835793 6:126158996-126159018 CAGTAGCAGTAGCAACTGCAAGG - Intergenic
1017931214 6:158957312-158957334 CAGTACCAGGTGCTACTGCATGG + Intergenic
1019453657 7:1113386-1113408 CAGGAGCAGCTGCTGCTGCCCGG - Intronic
1020055832 7:5117158-5117180 CAGGATCACGAACTCCTGCAGGG - Intergenic
1021704114 7:23350064-23350086 CAGGATCAGATGCCACTGCAGGG + Intronic
1023207505 7:37766575-37766597 CAGGGTCAACAGTGACTGCAGGG + Intronic
1024989994 7:55225871-55225893 CAGGAAGAACAGCTAGTGCATGG - Intronic
1026793776 7:73352537-73352559 CAGGATCAGCACCTGCAGAATGG - Intronic
1029290487 7:99498862-99498884 CAGGGACAGCAGGTACTGAATGG - Intronic
1029835852 7:103308987-103309009 CAGCTTCAACAGCTATTGCAAGG - Exonic
1032163298 7:129526824-129526846 CAGGAGCAGCAGCCACTCCAGGG - Intergenic
1032852220 7:135804883-135804905 CAGGAGCAGTAGCTTCTGCTAGG - Intergenic
1034693146 7:153029941-153029963 CAGGCTGAGGAGTTACTGCATGG + Intergenic
1035275402 7:157745298-157745320 CTGGATGAGAAGCTTCTGCACGG + Intronic
1036562739 8:9910972-9910994 CATGATGGGCATCTACTGCAGGG + Intergenic
1038793890 8:30693013-30693035 AATGATCAGCACCAACTGCACGG - Exonic
1039210272 8:35205116-35205138 CAAGGACACCAGCTACTGCAGGG - Intergenic
1039891190 8:41686602-41686624 CAAGGTCAGCAACTTCTGCAAGG + Intronic
1040477012 8:47787640-47787662 CAGGATCAGGTGCTGCTGCAGGG + Intronic
1040724505 8:50366268-50366290 CAGTATCAGGAACTACTACATGG + Intronic
1041731546 8:61068297-61068319 CAGAATCAACAGCTTCTTCAAGG + Intronic
1042363250 8:67906758-67906780 CAGCATGAGCCGCTACTACAAGG + Intergenic
1044817374 8:96126842-96126864 CAAGAGCAGCAGCTGCTACAAGG - Intergenic
1051267078 9:15319376-15319398 CTGGCTCAGCAGTTACTGCTGGG + Intergenic
1053056155 9:34994107-34994129 CAGAATTAGCAGCTACATCATGG - Intronic
1055294456 9:74820127-74820149 CAGGATAAATAGCTAATGCATGG - Intronic
1056542323 9:87582936-87582958 CAGCAGCAGTAGCTGCTGCATGG + Intronic
1058130481 9:101247190-101247212 CATGAGCAGCAGCTCCTGGAAGG + Intronic
1058578567 9:106430306-106430328 CAGGAACAGCAGTTACCACAAGG - Intergenic
1058665649 9:107312919-107312941 GAGTAGCAGCAGCTACAGCATGG - Intronic
1058835303 9:108854808-108854830 CAGGAGCGGCAGCCACTGCAGGG + Exonic
1059477993 9:114563507-114563529 CACATTCAGCAGCTTCTGCAGGG - Intergenic
1061473068 9:130842819-130842841 CTGGATCTGCGGCCACTGCAGGG + Intronic
1061573369 9:131491453-131491475 CAGGATCAGTGGCTGCTGCCCGG - Exonic
1062151535 9:135021688-135021710 CAGCACCAGCAGCTGCTCCATGG - Intergenic
1203781381 EBV:102844-102866 CAGGTTCAGCAGCTCCTTCTTGG - Intergenic
1187200050 X:17126186-17126208 CAGCAACAGCTGCTACCGCAGGG + Intronic
1187311792 X:18151574-18151596 CTGTAGCAGCAGCTACAGCAAGG - Intergenic
1187652331 X:21422274-21422296 CAGGATCAGCAGCTACTGCATGG + Intronic
1189860284 X:45264529-45264551 CAGCATCAGCTGATCCTGCAGGG - Intergenic
1195453169 X:105038282-105038304 CAGGATCAGATGCTACTGAGAGG - Intronic
1196779720 X:119372945-119372967 CAGGATAAATAGCTAATGCATGG + Intergenic
1199072175 X:143489885-143489907 CAGGATCCACTTCTACTGCACGG + Intergenic
1200055472 X:153457717-153457739 CAGGAGCAGCAGCTCCTGCGGGG + Intronic