ID: 1187654357

View in Genome Browser
Species Human (GRCh38)
Location X:21453359-21453381
Sequence GAGTTTAAACAGAAGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187654357 Original CRISPR GAGTTTAAACAGAAGGATGT GGG Intronic
901783560 1:11610065-11610087 CAGGTTAAACACATGGATGTTGG - Intergenic
902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG + Intronic
903980290 1:27181695-27181717 TTGTTTAAAAAGAGGGATGTCGG + Intergenic
905549553 1:38825316-38825338 GAGTGTGAACAGAACCATGTTGG - Intergenic
906466836 1:46089263-46089285 GAATTCAAACAGGAGGATGAAGG + Intronic
908415002 1:63904562-63904584 GAATTTAAAGAGAAGGAGGAAGG - Intronic
908621952 1:65991994-65992016 GAGCTTAAACAGAAGAATGAGGG + Intronic
910149845 1:84129857-84129879 GAGTCTAAGCTGGAGGATGTAGG - Intronic
911804146 1:102184419-102184441 TAATTTAAACAGGAGGATGTGGG + Intergenic
914027841 1:143928164-143928186 GAGTCAAAAGAGGAGGATGTAGG + Intergenic
916997140 1:170313131-170313153 GAGGTTGAAAAGAAGAATGTAGG - Intergenic
917231436 1:172841904-172841926 GGGTTTGAAGAGAAGTATGTGGG + Intergenic
917560361 1:176146233-176146255 CAGATTAAACAAAAGGGTGTTGG - Intronic
918470519 1:184868136-184868158 GAGGTAAAAAAGAAGGAAGTTGG - Intronic
918900607 1:190411854-190411876 GAGCTTGAAAAGATGGATGTAGG + Intronic
920157551 1:203967292-203967314 TTGTTTAAAAAGAAAGATGTTGG - Intergenic
920347367 1:205314973-205314995 GAGTTGAAAGAGATGGATCTTGG - Intronic
921474440 1:215589439-215589461 GAGTTTAAACAAAAAGAAATTGG - Intronic
924035463 1:239931680-239931702 AAGTATGAACAGAAGCATGTGGG - Intergenic
924099607 1:240589902-240589924 GAATTTCAACAGGCGGATGTTGG + Intronic
924528209 1:244870798-244870820 AAGTCTAAACATAAGTATGTAGG + Intergenic
1063090852 10:2865245-2865267 GAGATTACACAGCAGGAGGTGGG - Intergenic
1064287423 10:14004016-14004038 GAGACCATACAGAAGGATGTGGG + Intronic
1066083925 10:31958830-31958852 TTATTTAAAAAGAAGGATGTTGG - Intergenic
1067574311 10:47398775-47398797 GAGTGTAAAGAGAAGGAAATTGG + Intergenic
1068306326 10:55213026-55213048 GTGTTTGAACAGAAGGAATTAGG - Intronic
1069004298 10:63299770-63299792 GAATTTGAACACAAGGATGAGGG - Intronic
1069766784 10:70867701-70867723 GAGTTCAAACAAAAAGACGTAGG - Intronic
1072677103 10:97475796-97475818 AAGTAAAAACAGAAGAATGTGGG + Intronic
1073913895 10:108379508-108379530 AAGTTAAAACAGAATGATTTAGG - Intergenic
1074910846 10:117906909-117906931 AAGTATAAACAGAATGATGGAGG + Intergenic
1075397458 10:122137927-122137949 GACTTTGGACAGAAGGAGGTGGG + Intronic
1075794449 10:125109166-125109188 TTCTCTAAACAGAAGGATGTGGG - Intronic
1077806294 11:5594603-5594625 CAGTTAAAAAAAAAGGATGTTGG - Intronic
1078097591 11:8310225-8310247 AAGTCTAATCAGAAGGTTGTGGG + Intergenic
1078941952 11:16016435-16016457 TAGTTTAAATAGCAGTATGTAGG + Intronic
1081220974 11:40461056-40461078 AAGTTTAAACAGATGGGTATAGG + Intronic
1081595699 11:44457982-44458004 GTCTTTCAACAGAAGGATGGGGG - Intergenic
1082792744 11:57358507-57358529 GAAGTAAAGCAGAAGGATGTGGG + Intronic
1082992022 11:59214945-59214967 TAGTTTGAAGAGAAGTATGTAGG - Intergenic
1086916958 11:92541403-92541425 GAGTTTAAACAAAAGCAGTTAGG - Intronic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1088100099 11:106145232-106145254 TTGTTTAAAAAGAAGGATGTTGG + Intergenic
1091165429 11:133471695-133471717 GAGGTAAAACAGAAGGATTGAGG + Intronic
1092296375 12:7202334-7202356 GAGTTTATACAGCAGCAGGTAGG + Exonic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093451746 12:19323947-19323969 GAGTTTAAACAGCTGGCTTTAGG + Intronic
1093887406 12:24478314-24478336 AAGTACAAACAGAAAGATGTAGG - Intergenic
1094371754 12:29746129-29746151 GATTTTAAAATGAGGGATGTGGG + Intronic
1095434478 12:42171975-42171997 GAGTTTAAAAACAAGTATTTAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097717060 12:62978246-62978268 GAATTTAGACATAAGGAAGTTGG + Intergenic
1099731212 12:86505907-86505929 GATTTTAAACAGAAGAAGGCAGG + Intronic
1100561908 12:95755542-95755564 GAGTATAAGCAAAAGGATTTTGG - Intronic
1101281820 12:103265227-103265249 GAATTTCAACATAAGAATGTTGG + Intronic
1101679367 12:106949856-106949878 GACTTGAAAAAGAAAGATGTTGG - Intergenic
1104163091 12:126199647-126199669 GAGATTAAACAGAGGAATGATGG + Intergenic
1105649325 13:22357441-22357463 GTCTTTAAACTGTAGGATGTGGG + Intergenic
1107864984 13:44694826-44694848 TAGTTCAAACAGTAGGATCTCGG + Intergenic
1109658003 13:65419987-65420009 GATTTTAAACAGCAGAATGATGG - Intergenic
1111053865 13:82922399-82922421 GACTTTTGACAGAATGATGTTGG + Intergenic
1111434480 13:88188786-88188808 GAATTTAAACGCAATGATGTAGG + Intergenic
1112246649 13:97741280-97741302 CATTTTACACAGAAAGATGTAGG - Intergenic
1113820025 13:113206952-113206974 AAGTTTAAACAGACAGATTTGGG - Intronic
1114715473 14:24819409-24819431 GAGTTTATAGAGAAGCATTTAGG - Intronic
1114909812 14:27176679-27176701 GAGTTTCAACATACGGATGTAGG + Intergenic
1116391099 14:44390858-44390880 GAGTTGAACTAGAAGGTTGTAGG - Intergenic
1118499164 14:66341760-66341782 TATTTTAAACAGAAACATGTTGG - Intergenic
1119143691 14:72291088-72291110 GAGATCAAGCAGAAGGATCTAGG - Intronic
1119828041 14:77674362-77674384 CAGTTTAAAAAGGAGGATTTGGG - Intronic
1120014373 14:79453779-79453801 GAGTAAAAAAAGAAGGATCTGGG - Intronic
1120666278 14:87310208-87310230 TATTTTAAACACAAGGATGGTGG - Intergenic
1121034491 14:90689129-90689151 GATTTTAAACAAAAGGATCAAGG + Intronic
1121843195 14:97151554-97151576 GAGTTTGCACTGAATGATGTTGG + Intergenic
1123204356 14:106698133-106698155 GAGTAGAAACAAAAGAATGTGGG + Intergenic
1123209364 14:106744604-106744626 GAGTAGAAACAAAAGAATGTGGG + Intergenic
1125027888 15:35049042-35049064 GAGTTTAAGTAAAATGATGTTGG + Intergenic
1125243877 15:37611160-37611182 GTTTTTAAACGGATGGATGTAGG - Intergenic
1125384165 15:39119069-39119091 GGTTTTAACAAGAAGGATGTTGG - Intergenic
1126538174 15:49791540-49791562 GAGTTTAAACTGAAGGTTTGAGG - Intergenic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1127284522 15:57520837-57520859 CAGCTTAACCAGAAGGAAGTTGG - Intronic
1127488640 15:59441581-59441603 CAGTTTCAACAGAAAGATGAGGG - Intronic
1127641122 15:60916914-60916936 GACTTTATTAAGAAGGATGTTGG - Intronic
1128340510 15:66819481-66819503 GGGTTTAAACAGAAGTCTGTTGG + Intergenic
1129974900 15:79813833-79813855 GAGATTAAATAGAAGGATTCAGG - Intergenic
1130237756 15:82153131-82153153 GATTTTAAACAGCTGCATGTGGG + Intronic
1130688176 15:86057290-86057312 GATTTTAAACAGGATGATGATGG - Intergenic
1134507018 16:14816114-14816136 GAGGTTAAACAGACTGTTGTTGG + Intronic
1134573541 16:15312712-15312734 GAGGTTAAACAGACTGTTGTTGG - Intergenic
1134633966 16:15778220-15778242 GAGTTTACCCAGAAGAATGCTGG - Intronic
1134728881 16:16443603-16443625 GAGGTTAAACAGACTGTTGTTGG + Intergenic
1134938563 16:18268321-18268343 GAGGTTAAACAGACTGTTGTTGG - Intergenic
1135195588 16:20391768-20391790 GAGGTTAAAAAGAAGGCAGTGGG + Intronic
1136641895 16:31572897-31572919 GACTTTCAACAGTATGATGTTGG - Intergenic
1139411832 16:66768420-66768442 GATTATAAAAAGAAGGAAGTAGG + Intronic
1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG + Intronic
1144179483 17:12738345-12738367 GAGTTGAAACAGAGGAATATAGG + Intronic
1146633755 17:34489119-34489141 GATTTGAAATAAAAGGATGTGGG - Intergenic
1147915415 17:43882634-43882656 GAATTTAGGCAGAAGGATGGAGG - Intronic
1150247157 17:63685143-63685165 GAGTGTAAACAGAAGCATTAAGG + Intronic
1150690651 17:67364276-67364298 GTGTTTAAAAAAAAGAATGTTGG - Intronic
1151179129 17:72313030-72313052 GAGTAGAAAAAGAAGGAAGTTGG - Intergenic
1153504522 18:5782134-5782156 GTTTTTACACAGAAGGATGGAGG + Intergenic
1156663926 18:39382585-39382607 GGTTTTAAACAAAAGGATTTGGG - Intergenic
1156824112 18:41409229-41409251 AAGTTTGAACAGAAGGATTAGGG + Intergenic
1156932134 18:42658412-42658434 GAGTCTACACAGGAGGAGGTGGG + Intergenic
1157938259 18:51896743-51896765 GAGGTTAATCAGAAAGACGTGGG - Intergenic
1158400376 18:57116345-57116367 AAGTTTCAACAGATGGATTTGGG + Intergenic
1158891359 18:61875121-61875143 GAGTTTGAATAGAAGGATAGAGG + Intronic
1159702432 18:71645625-71645647 GATTTTTAACAGAAAGAAGTAGG + Intergenic
1163529412 19:17841125-17841147 GAGATTAAACAAGAGGCTGTAGG + Intronic
1164237125 19:23346959-23346981 GTGTTGATACAGAAGTATGTAGG - Intronic
1166015987 19:39979843-39979865 GAGTTTGTACAGAAGTATCTGGG + Exonic
1167193651 19:48010340-48010362 GAGTTTCACCACAAGTATGTGGG - Intronic
925055970 2:857580-857602 AAGTTTCAACACAAGGATGTGGG + Intergenic
926994915 2:18724415-18724437 GAGCTTCCACAGAGGGATGTGGG + Intergenic
927501762 2:23588049-23588071 GAGGTTACAGAGAAGGATGAGGG - Intronic
928219986 2:29395520-29395542 GACTTTAAACTGAAGGACATTGG + Intronic
928604876 2:32936353-32936375 GATTTTACAAAGAAGGATGGTGG - Intergenic
929630806 2:43460016-43460038 TAGTTCAGACACAAGGATGTTGG + Intronic
930257809 2:49111726-49111748 GAGTTTTCACAGAAGGCTCTGGG + Intronic
931912385 2:66914809-66914831 GAGTGTAAACAGAATGAAATTGG + Intergenic
933167804 2:79094863-79094885 GTGTTCAAACAGAAGTGTGTAGG + Intergenic
935390291 2:102544342-102544364 AAGTTTCAACAAAAGCATGTAGG + Intergenic
935402138 2:102671146-102671168 GAGTTTACAGAGAAGGAAGCGGG + Intronic
936024150 2:109018475-109018497 GGGTTTAATCAGGAGGATGGTGG - Intergenic
937789587 2:125944231-125944253 GAGTAGAAACAGAGGAATGTGGG - Intergenic
937789652 2:125944801-125944823 GAGTAGAAACAGAGGAATGTGGG - Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
938451868 2:131428210-131428232 GTGTTTTAGCAGAAGGAAGTTGG + Intergenic
939696344 2:145329401-145329423 CAGTTTCAGCAGAAGGATTTTGG - Intergenic
941514715 2:166458968-166458990 AAATTTATACAGAAGTATGTAGG + Intronic
941920032 2:170841063-170841085 GATTTAAAACAGTAGGATGGTGG - Intronic
941988281 2:171529589-171529611 CAGTCTACTCAGAAGGATGTAGG + Intronic
942316702 2:174703031-174703053 GAGTTTAAAATGAAGCGTGTAGG - Intergenic
943102029 2:183498513-183498535 GCATTTTGACAGAAGGATGTAGG - Intergenic
943132604 2:183873326-183873348 AAATTGGAACAGAAGGATGTGGG - Intergenic
943726731 2:191259347-191259369 GAGTTTAAAAAGATGTTTGTGGG + Intronic
946562937 2:220933582-220933604 GAGTGAAACCATAAGGATGTGGG - Intergenic
1171493753 20:25539766-25539788 GAGTCTAAACAGAGGGCTTTGGG - Intronic
1172936236 20:38622576-38622598 GGGATTAAAGGGAAGGATGTGGG + Intronic
1173190305 20:40870890-40870912 GAGGTTATACAGAAGTAGGTTGG - Intergenic
1173220898 20:41132215-41132237 GAGCCTAAACAGCAGGTTGTGGG + Intergenic
1175124371 20:56740491-56740513 CAGTTTCAACACATGGATGTGGG + Intergenic
1177771858 21:25525911-25525933 GACATTAAAGAGAATGATGTAGG - Intergenic
1178773632 21:35528599-35528621 GGGTTGAAAAAGAAAGATGTAGG + Intronic
1179904256 21:44414035-44414057 GAGGTTGAGCAGCAGGATGTTGG - Exonic
1180565280 22:16658717-16658739 GGGTCTAAAAAGGAGGATGTGGG - Intergenic
1182986801 22:34726390-34726412 GAGTTTAAACAAAAGGACACTGG + Intergenic
1185183775 22:49380215-49380237 GAATTAAAACAGCAGGATGCAGG + Intergenic
949643220 3:6063586-6063608 GTTTTTAAACAGAAGGAAATAGG + Intergenic
951701731 3:25503733-25503755 AAGTTGAAACAGAAGGAAGCAGG + Intronic
954588579 3:51759771-51759793 AAGTTTAAACAAAAGAATTTAGG - Intergenic
954652435 3:52173353-52173375 GAGGCAAAACAGAAGGATGCAGG + Intergenic
956310402 3:67872355-67872377 AAGTTTAAGCACAAGTATGTAGG - Intergenic
957684295 3:83481007-83481029 AGGTTTAAACAGAAGAATTTTGG - Intergenic
957842209 3:85686157-85686179 GATATTAAACAGAAGGAAGTAGG - Intronic
957846967 3:85750133-85750155 GATATTAAACAGAAAGATATGGG - Intronic
957959725 3:87233737-87233759 GAGATTATAAAGTAGGATGTGGG + Intronic
958946302 3:100366183-100366205 GAGATGAAACAGAAAGAGGTGGG - Intronic
959390696 3:105769904-105769926 GAGACTAATCAGAAGGTTGTTGG + Intronic
960082448 3:113555579-113555601 GATTATAAACAAAAGGATGAAGG + Intronic
963291798 3:143497805-143497827 GATTATAAACAAAAGGGTGTGGG + Intronic
963589490 3:147239292-147239314 GATTTTAAAAAGAAGGAAGAAGG + Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
968332213 3:197880531-197880553 GAGGTTTAGCTGAAGGATGTCGG - Intronic
968718256 4:2178000-2178022 GAGATTTATCAGAAGGATATGGG - Intronic
969220600 4:5756152-5756174 CAGGTTAGAAAGAAGGATGTTGG - Intronic
969932877 4:10649160-10649182 TAGTTAAAATAGAAGGAAGTAGG - Intronic
970114656 4:12681155-12681177 GACTTTATTCAGAAGGAAGTAGG - Intergenic
971495820 4:27264147-27264169 TAGATTAAACAGAAGGTTATGGG + Intergenic
971805376 4:31351685-31351707 GAGTTTCAACATATGGATTTGGG - Intergenic
972566540 4:40274497-40274519 CAGTTTTAGCAGAAAGATGTTGG + Intergenic
974136606 4:57826011-57826033 TAATTTTAACAGCAGGATGTTGG + Intergenic
975005537 4:69279272-69279294 GATTTTTAACAGAAAGAAGTGGG + Intergenic
975306742 4:72858062-72858084 GAGTGTTAACAGAGGCATGTAGG - Intergenic
975545480 4:75556277-75556299 GTGGTTAAAGAGAAGGAAGTTGG + Intronic
976575608 4:86667094-86667116 GAGTTTAAAAAGAATTATTTAGG - Intronic
979312535 4:119220849-119220871 GAATTTATAGACAAGGATGTGGG + Intronic
979343428 4:119556343-119556365 CATTTTAAACAGTAGGATGGGGG - Intronic
980989564 4:139727783-139727805 GAGGGAAAACAGAAGGATTTGGG - Intronic
981283500 4:142988980-142989002 GAATTGAAACAGAAGGATGCTGG - Intergenic
981423181 4:144574704-144574726 ATATTTAGACAGAAGGATGTGGG - Intergenic
983864590 4:172749606-172749628 AAGTTTAAAAAGAGGGATTTGGG - Intronic
985534836 5:458379-458401 GAGTTTAAACAGGTGGATTTTGG + Intronic
989220121 5:38949401-38949423 GATTTTAAAAAGAAGCATGTCGG - Exonic
990258784 5:53999116-53999138 GAGAATAAAGAGAAGGCTGTAGG + Intronic
990703416 5:58500086-58500108 CAATTTAAAAGGAAGGATGTTGG + Intergenic
991082642 5:62617889-62617911 CAGTTTATACAGAAGGCTGTGGG - Intronic
991609778 5:68437998-68438020 GAGTATAAGGAGAAAGATGTGGG + Intergenic
992530423 5:77646849-77646871 GACTTGAGACAGAAGGATTTGGG + Intergenic
994791840 5:104237153-104237175 GAGTGAGAACAGAAGGAGGTGGG + Intergenic
994926534 5:106122952-106122974 GACTTTAAACAGAAGGGTCAGGG + Intergenic
996634262 5:125671108-125671130 GAGTTTACATGAAAGGATGTGGG - Intergenic
996804592 5:127440648-127440670 AAGTTTAAACACAAATATGTTGG + Intronic
996952578 5:129145628-129145650 GAGGTTAAAGAGATAGATGTTGG - Intergenic
997090879 5:130856100-130856122 GAGTTCAAACAGAAAGACATGGG + Intergenic
997912304 5:137888423-137888445 TAGTTTTAACAAAAGGATTTGGG - Intronic
998100636 5:139430869-139430891 GATTTTAAAAAGAATGAGGTAGG - Intronic
999895462 5:156028079-156028101 AAGTTTCAACAGAGGGATTTTGG + Intronic
1000368008 5:160508829-160508851 GCTTTTAAAGAGAAAGATGTGGG + Intergenic
1000774303 5:165398601-165398623 GAGTTTAGAAATAAGAATGTAGG - Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1002393636 5:178936466-178936488 GAGTTAAAACAGAAAGAAGGGGG - Intergenic
1003939384 6:11009203-11009225 GGGTTGAAACAGAATGATGAGGG + Intronic
1004158295 6:13190446-13190468 GAGTTTCAACAGATGAATTTAGG + Intronic
1005326989 6:24711876-24711898 GAGTGTAAGCAGTATGATGTAGG - Intronic
1007166816 6:39834305-39834327 GAGTGAAAAAAGAAGGATGTAGG - Intronic
1007747723 6:44053364-44053386 AAGTTTAAACAGCAGTGTGTGGG + Intergenic
1009349263 6:62653478-62653500 GAGGTTAGAAAGAAAGATGTGGG + Intergenic
1010348992 6:74849342-74849364 AAGTTTAAAGAGAAGGATGTAGG - Intergenic
1010568053 6:77442053-77442075 CAGTTAAAAAAGAAGCATGTTGG + Intergenic
1013423401 6:109987385-109987407 GAGTATAGACAGGAGGAGGTGGG + Intergenic
1013490036 6:110637429-110637451 GTGTTTAAAGAAAAGGAAGTTGG + Intronic
1014653125 6:124065992-124066014 GAGATTAAAGAGAAGGAAGTGGG + Intronic
1014806373 6:125834116-125834138 GAGTATTAACAGAAATATGTGGG + Intronic
1016256557 6:142112562-142112584 GAGTTTAGAAATAAGGATGTTGG - Intergenic
1018057366 6:160063799-160063821 GAGTACATACTGAAGGATGTTGG + Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019867499 7:3726120-3726142 GACTTTATAGAGAAGGATCTAGG + Intronic
1020429723 7:8106620-8106642 GACTTTACACAGAAGGATGCTGG + Intergenic
1020461900 7:8436113-8436135 GAGTTTAAACGAAGGGAAGTGGG + Intronic
1021029863 7:15718152-15718174 TAGCTTAAACAGAACGTTGTGGG + Intergenic
1021272152 7:18603122-18603144 CACACTAAACAGAAGGATGTTGG - Intronic
1021682919 7:23153056-23153078 TGGTTTATCCAGAAGGATGTAGG - Intronic
1023224717 7:37957451-37957473 GTGTTTTCGCAGAAGGATGTTGG + Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1024529668 7:50380941-50380963 GAGTTTAAACGTAAGCAGGTTGG - Intronic
1024599998 7:50972045-50972067 CAGTTTAAACACATGGACGTTGG - Intergenic
1024989446 7:55221389-55221411 GAGTTGAAGCAGCAGGGTGTTGG + Intronic
1025284210 7:57649384-57649406 GTGTGTAAACAGAGGAATGTGGG + Intergenic
1027227715 7:76254905-76254927 AAGTTTAAACAAAGGAATGTGGG + Intronic
1029227467 7:99038531-99038553 GAAATAAGACAGAAGGATGTAGG + Intronic
1030995357 7:116352819-116352841 GAGTCTACACAGAAGGATGTGGG + Intronic
1031783860 7:126004062-126004084 GAGCTTCAGCAGAAGTATGTGGG + Intergenic
1033227789 7:139574819-139574841 GGGTTGAAACAGCAGTATGTGGG + Intronic
1041147682 8:54895156-54895178 GACTTTGAACTGAAGGACGTTGG + Intergenic
1044533778 8:93337200-93337222 GAGATAAGACAGAAGAATGTGGG + Intergenic
1044598269 8:93979373-93979395 GAATTTGAACACAAGTATGTAGG - Intergenic
1044996759 8:97844692-97844714 GACTTTCAACACAAGGAAGTAGG - Intronic
1045198210 8:99951608-99951630 GAGGTTAAAAAAAAGAATGTTGG - Intergenic
1045631850 8:104133631-104133653 CAGTTGAAACATAAGCATGTAGG + Intronic
1045849797 8:106681324-106681346 AAGTTTGCATAGAAGGATGTAGG + Intronic
1046117932 8:109806795-109806817 CAGTTTGAACATAAGGATGGGGG + Intergenic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048790868 8:138102089-138102111 GAGGTAAATCAGAAGGATGGAGG + Intergenic
1051978358 9:22982370-22982392 GAGTTTTGACAGATGGATCTCGG - Intergenic
1054519666 9:66065432-66065454 GAATTTAAAAAGAATGATTTTGG - Intergenic
1055438282 9:76314362-76314384 GTGTTTAAACACAAAGATGAGGG - Intronic
1055679566 9:78701326-78701348 GAAGTTTAGCAGAAGGATGTAGG + Intergenic
1055884811 9:81049018-81049040 GATTTTACATAGAATGATGTGGG - Intergenic
1055967215 9:81877147-81877169 CAATTTACACAGAAGGAAGTAGG - Intergenic
1057278348 9:93689489-93689511 GAGTTTTAACAAAAGTATGAGGG + Intergenic
1057978826 9:99636985-99637007 GAGTTTCAACAGCAAGAGGTAGG + Intergenic
1059163131 9:112053932-112053954 GATTTTAAACAGAATTAAGTTGG + Intronic
1061241658 9:129378018-129378040 GTCTTTACACAGAAGGATGTCGG + Intergenic
1187654357 X:21453359-21453381 GAGTTTAAACAGAAGGATGTGGG + Intronic
1191151277 X:57222761-57222783 GTGTTTACACAGAAGTGTGTAGG - Intergenic
1192672107 X:73155932-73155954 GTGTATAAACAGTAGAATGTGGG - Intergenic
1192860048 X:75058040-75058062 GAGTATAAACACCAGGCTGTGGG + Intronic
1193632865 X:83911295-83911317 GTGTTAAAGCAGAAGGACGTTGG - Intergenic
1195259238 X:103116541-103116563 GGGTTCAATCAGCAGGATGTGGG - Intergenic
1196429201 X:115604571-115604593 ATGTTTTAACAGAAAGATGTTGG - Intronic
1198376715 X:136048164-136048186 GATTGTAACCAGAAGGATGAAGG + Intergenic
1199298259 X:146183577-146183599 AAGTTTAAGCTCAAGGATGTGGG - Intergenic
1199300328 X:146205729-146205751 GAGTGCAAACAAAAGGATGGTGG + Intergenic
1200414482 Y:2894286-2894308 AAGTTAAAACAAAAGGATGCTGG - Intronic