ID: 1187654964

View in Genome Browser
Species Human (GRCh38)
Location X:21461644-21461666
Sequence CAACCTATGAAACTACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187654964_1187654967 28 Left 1187654964 X:21461644-21461666 CCTGGCAGTAGTTTCATAGGTTG 0: 1
1: 0
2: 1
3: 24
4: 138
Right 1187654967 X:21461695-21461717 TTTTATTTGAATTTTGTATATGG 0: 5
1: 94
2: 726
3: 1982
4: 11017

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187654964 Original CRISPR CAACCTATGAAACTACTGCC AGG (reversed) Intronic
901305158 1:8227438-8227460 CAACCTCTGAAACCTCTGACCGG - Intergenic
904962127 1:34341867-34341889 CCACCTATTAGACTCCTGCCGGG - Intergenic
905886077 1:41492867-41492889 CATCCTATGAAAATTCTACCTGG - Intergenic
907621068 1:55981223-55981245 CAAGCTATGAATCTACAGCAGGG - Intergenic
907638248 1:56158087-56158109 CAACCTATAAAAATACAGGCCGG + Intergenic
916379573 1:164194997-164195019 CAAACTATGAAACTACTACAAGG + Intergenic
916888859 1:169097191-169097213 TATCCTATGAGACCACTGCCTGG + Intergenic
917580436 1:176372071-176372093 CAAACTATGAAACTACTGGAAGG - Intergenic
917801778 1:178577966-178577988 AAACCCATGAAACCACAGCCAGG - Intergenic
917930727 1:179820843-179820865 CAGCCTGTGCCACTACTGCCAGG + Intergenic
918665783 1:187148915-187148937 CAAACTATGAAACTACCTCAAGG - Intergenic
918701224 1:187610809-187610831 CAAACTATGAAACTACTAGTAGG + Intergenic
924057270 1:240136352-240136374 AAATCTATGAAACTACTGACTGG - Intronic
924329577 1:242928466-242928488 CAACCCATAAATCTGCTGCCTGG + Intergenic
1062911572 10:1215511-1215533 CAACCTTTGCATCTCCTGCCTGG + Intronic
1065507091 10:26439455-26439477 CAAATTATGAAACTTGTGCCTGG - Intronic
1066136985 10:32458136-32458158 AAAACTATGAAACTACTGGAAGG - Intronic
1066410077 10:35159604-35159626 AAAACTATGAAACTACTACAAGG + Intronic
1067359696 10:45567386-45567408 CAAACTATGAAACTACTACAAGG - Intronic
1070078930 10:73166921-73166943 CAAACTATGAAACTACTAAAAGG - Intronic
1071731664 10:88254347-88254369 CAAACTATGAAATTAAGGCCAGG + Intergenic
1072878127 10:99196239-99196261 CAAACTATGAAACTACTAAAAGG + Intronic
1073165248 10:101442399-101442421 CAGCCTATGGAACTACTACGTGG + Intronic
1076205109 10:128591505-128591527 CAACCTATCAACCTAAGGCCAGG - Intergenic
1077949360 11:6939246-6939268 CAACCTATTAAAAGACTGTCAGG + Intronic
1086028392 11:82323058-82323080 CAACCTGTGCCACTACTGCTTGG - Intergenic
1087350483 11:97025593-97025615 CCAACTATGAAACTACTGCAAGG + Intergenic
1087371486 11:97290853-97290875 TTAGCTAAGAAACTACTGCCTGG + Intergenic
1087380038 11:97393794-97393816 CAAACTGTGAAACTACTACAAGG - Intergenic
1088150224 11:106736241-106736263 CAAACTATGAAACTACTAAAAGG - Intronic
1089714375 11:120343438-120343460 AAGCCTATGAAGCTAGTGCCTGG + Intronic
1089863843 11:121614892-121614914 CATCCTATGAGATTTCTGCCTGG + Exonic
1091986651 12:4915097-4915119 CAACCTGTGAAGTGACTGCCAGG - Exonic
1092897125 12:13022716-13022738 CAACCAATTAGACTACTGCTTGG - Intergenic
1095530619 12:43182424-43182446 CACCCTCTGAAACAACAGCCTGG + Intergenic
1095828246 12:46553430-46553452 CAAGTTATGAAACTATTGCAGGG - Intergenic
1097794797 12:63850067-63850089 CACCCTGTGAAGCTGCTGCCTGG - Intronic
1098651791 12:72979767-72979789 CAAACTAGGAATCTTCTGCCAGG + Intergenic
1101561418 12:105861333-105861355 TCACCAATGAAACAACTGCCTGG + Intergenic
1102788831 12:115626565-115626587 AAACATATGAAACTAATTCCAGG - Intergenic
1106075208 13:26454369-26454391 CAAACTGTGAAACTAGTGCAAGG + Intergenic
1109782085 13:67125054-67125076 CAACTCATGAAACTTCTGACTGG + Intronic
1110663709 13:78090428-78090450 AAACCTATGAAACTACTACAAGG + Intergenic
1111479187 13:88799792-88799814 AAAACTATGAAACTACTACAAGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112944223 13:104906505-104906527 CAAACCATGAAACTACTACAAGG - Intergenic
1115122002 14:29948498-29948520 CAACCCAGCAAACTTCTGCCTGG + Intronic
1115743209 14:36409782-36409804 CAACCTGTGAGGCTACAGCCTGG + Intergenic
1116263608 14:42661135-42661157 CAACCCATGAAACACCTGCAAGG + Intergenic
1116317923 14:43421498-43421520 CTTCCTTTGAAGCTACTGCCAGG + Intergenic
1118212330 14:63777086-63777108 CAACATATTAAACTACTGTCTGG + Intergenic
1122088894 14:99325171-99325193 CACCCTGTGACACCACTGCCTGG + Intergenic
1124180506 15:27468587-27468609 CATGATGTGAAACTACTGCCTGG + Intronic
1126528461 15:49685381-49685403 CAATATAGGAAACTCCTGCCAGG + Intergenic
1129500332 15:76030620-76030642 CAATCTATGAAACTACTGCAAGG + Intronic
1129642892 15:77399696-77399718 CAAACTATAAAACTACTACAAGG + Intronic
1132794867 16:1714930-1714952 CATCCTATGAAACATCTCCCTGG - Intronic
1135677291 16:24427032-24427054 CACACTATGAAACTACTACAAGG - Intergenic
1137985208 16:53101511-53101533 AAACTTATGAAGTTACTGCCTGG + Intronic
1138477927 16:57283240-57283262 CAACCTCTGAATCTCCTGGCGGG - Intronic
1140881645 16:79203792-79203814 AAACCTTTGAAATTATTGCCAGG - Intronic
1140972287 16:80024966-80024988 CAACCTAAGAAATTATTTCCTGG - Intergenic
1141397608 16:83718789-83718811 AATCATGTGAAACTACTGCCTGG + Intronic
1142217572 16:88837421-88837443 GAGCCTATGAGACTCCTGCCTGG - Intronic
1146862371 17:36314616-36314638 ATAGCTATGAAACTACTGGCAGG - Intronic
1147332804 17:39708800-39708822 CAACCTATGTAACTATTTGCTGG + Intronic
1153439526 18:5101232-5101254 AGTCATATGAAACTACTGCCTGG + Intergenic
1153455237 18:5273666-5273688 CAAACTATGAAACTACCACAAGG + Intergenic
1155282780 18:24257511-24257533 CAGACTATGAAACTACTACAAGG + Intronic
1156421626 18:36960226-36960248 CAACCTATGAGGCTGCAGCCCGG + Intronic
1157591585 18:48839305-48839327 AAACCTTTGAAGCTACAGCCAGG - Intronic
1165143607 19:33717801-33717823 TGTCATATGAAACTACTGCCTGG + Intronic
1165960175 19:39527549-39527571 TAACATATGAATATACTGCCGGG + Intergenic
927135793 2:20095453-20095475 CAACCTATCAATCAACTGCAAGG - Intergenic
929973201 2:46603739-46603761 CAAACTATGAAACTACTAAAAGG + Intronic
930894812 2:56433369-56433391 GAAACTATGAAACTACTACAAGG - Intergenic
934945772 2:98540311-98540333 TAACCTAGAAAACTACTGCTGGG - Intronic
939519186 2:143208021-143208043 CAGCCAAGGAAACTACTGCCAGG - Intronic
941749004 2:169116145-169116167 CAGCCTGTGGAACTACTGCTGGG + Intergenic
942502403 2:176605449-176605471 AAACCTATGTCACTACAGCCAGG + Intergenic
943724875 2:191243408-191243430 CAACATATGAACCTGCTACCTGG - Intergenic
943845487 2:192640630-192640652 CAAACTATGAAACTACTAAGAGG + Intergenic
944079066 2:195765259-195765281 CAAACTATGAATCTACTGTGAGG + Intronic
947082146 2:226410661-226410683 TAAACTATGAAAATACTGCTAGG + Intergenic
1169021329 20:2333311-2333333 CAATATATGAAGCAACTGCCTGG + Intronic
1180726942 22:17953360-17953382 CCACCTCTGAAACAACTTCCGGG + Intronic
1182244626 22:28946160-28946182 CAACTTATAAAACTACAGGCTGG - Intronic
1182907745 22:33952760-33952782 CAACAGATGAAACTATTGACTGG - Intergenic
1183318780 22:37151669-37151691 CAAACTATGAAACTACTAAAAGG - Intronic
1183557582 22:38543086-38543108 CAAACTATGAAACTACTAAAAGG + Intronic
949462789 3:4311485-4311507 CAGCCCATGAAACTGCTTCCTGG + Intronic
953846792 3:46433855-46433877 CAACCTTGGGAACTACTGCATGG + Intergenic
954777338 3:53031837-53031859 AAACCTGTGAACCTACTCCCAGG - Intronic
955341520 3:58129017-58129039 CAACCTATGGGGGTACTGCCGGG + Intronic
955460352 3:59175291-59175313 CAACCTAAGAAACTACTACAAGG - Intergenic
959113483 3:102149092-102149114 CAGCCTATGAGAATGCTGCCAGG - Intronic
959818215 3:110701657-110701679 CAAACTATGAAACTACTTCAAGG - Intergenic
965144679 3:164886261-164886283 CAACCTATGAAACTACTAAAAGG - Intergenic
969619131 4:8270103-8270125 CGACCTCTGCAACTGCTGCCTGG + Exonic
972236734 4:37143331-37143353 CAAACTATGAGACTACTACAAGG - Intergenic
975369088 4:73563175-73563197 CAAATTCTGAAACTACTGCAAGG - Intergenic
978221472 4:106280540-106280562 CAAGCTATGAAACTACTACAAGG - Intronic
978327667 4:107577388-107577410 CATCCTATCAAACTACTGGGTGG + Intergenic
979017465 4:115452435-115452457 CAACCTGTGAGACTGCAGCCTGG - Intergenic
979184883 4:117775657-117775679 CAAACAATGAAACTACTACAAGG + Intergenic
982682947 4:158454017-158454039 CAGCCTATGAAACTACTACAAGG - Intronic
984268201 4:177519686-177519708 AATCATATGAAACTGCTGCCTGG - Intergenic
984649805 4:182258756-182258778 CTACCTATTAAACTAATGTCAGG + Intronic
986046689 5:4044759-4044781 AAGCCCATGAAAATACTGCCAGG - Intergenic
986652245 5:9975724-9975746 CAAAGACTGAAACTACTGCCAGG - Intergenic
986775990 5:11014110-11014132 CAACCAATGCAACTACTTCTTGG + Intronic
987952161 5:24688989-24689011 CAAACTATGAAACTACTACAAGG + Intergenic
990143911 5:52736851-52736873 CAACCTGTGCAACTACTAGCAGG + Intergenic
990415100 5:55578839-55578861 CAAGCTATGAAAATCCAGCCTGG + Intergenic
993197980 5:84774932-84774954 CAAAATTTGAGACTACTGCCTGG + Intergenic
993974497 5:94460119-94460141 CAACATATGAAACCACTGTGTGG + Intronic
996280056 5:121719530-121719552 AATCATGTGAAACTACTGCCTGG - Intergenic
998114460 5:139525611-139525633 AAACCTATGAAAATTATGCCTGG + Intergenic
1000150751 5:158498301-158498323 CACCCTCTGTAACAACTGCCAGG + Intergenic
1005177842 6:23068391-23068413 TAAACTATGAAACTATTGCAAGG + Intergenic
1008904743 6:56663911-56663933 AAACCTATGAAAAGACTGCCAGG + Intronic
1010630775 6:78195118-78195140 CAAACTATGAAACTACTAAAAGG - Intergenic
1011520900 6:88204805-88204827 CAAACTATGAAACTACTAAAAGG + Intergenic
1012189571 6:96262685-96262707 CAAGTTATGAAACTACTACCAGG + Intergenic
1012833345 6:104233307-104233329 CAAACTGTGAAACAACTGTCTGG + Intergenic
1016185186 6:141190063-141190085 CAAACCATGAAACTACTACAAGG - Intergenic
1021272119 7:18602362-18602384 CAACTGATGAAACTACAGTCAGG - Intronic
1021870553 7:25001998-25002020 CAACCTATGAGGCTGCAGCCTGG - Intergenic
1021932950 7:25599665-25599687 CAACCTCTGAAGCTACTGAGTGG + Intergenic
1024476840 7:49820967-49820989 CCACCTATGGAACTACAGTCTGG + Intronic
1028140039 7:87263573-87263595 CAACCTGTGACACTGCAGCCTGG - Intergenic
1030752928 7:113253530-113253552 CAAACTATGAAACTACTATAAGG + Intergenic
1035051624 7:156002107-156002129 AAACTTATGAAACCACTGCGAGG + Intergenic
1035110497 7:156477888-156477910 AAAACTATGAAACTACTGGAAGG + Intergenic
1041365900 8:57104434-57104456 CAAACTATGAAACTACTACAAGG + Intergenic
1043739835 8:83797025-83797047 CAATCTGTGAAACTACTAACAGG - Intergenic
1043829887 8:84975023-84975045 CAAACTATGAAACTACCAGCAGG + Intergenic
1045710134 8:104973936-104973958 CTACCTATCAAATTACTGCCTGG + Intronic
1048556490 8:135482878-135482900 CACCTTATTAAACTAGTGCCTGG + Intronic
1050522447 9:6515478-6515500 CAAACTATAAAACTACTACAAGG - Intergenic
1050783898 9:9374500-9374522 CATCCTATTAAACTACTTTCTGG - Intronic
1052388782 9:27853910-27853932 CAACAAAAAAAACTACTGCCAGG - Intergenic
1057241155 9:93410708-93410730 CAAACTATGAAACTACTACACGG - Intergenic
1057616039 9:96591084-96591106 CAAACTTTGAAACTTCTGCTCGG - Intronic
1187654964 X:21461644-21461666 CAACCTATGAAACTACTGCCAGG - Intronic
1188625427 X:32278698-32278720 CAAACTAAGAAACTACTACAAGG + Intronic
1188742676 X:33805567-33805589 CAAACTATGAAACTACTAGAAGG - Intergenic
1188924064 X:36017495-36017517 CAAACTATGAAACTTCTACAAGG - Intergenic
1188982490 X:36739480-36739502 CAACCTATGAACTTTCTGCCAGG + Intergenic
1193610244 X:83622797-83622819 CATACTATGAAACTACTACAAGG - Intergenic
1194083201 X:89493520-89493542 CAAACTATGAAACTCCTGCAAGG - Intergenic
1194247155 X:91529641-91529663 CAAACCATGAAACTACTGCAAGG - Intergenic
1194546763 X:95245176-95245198 CAAAATATGAAACTACTACAAGG + Intergenic
1195263253 X:103154665-103154687 CATCCTAAGAAACTGCTGGCTGG + Intergenic
1195808372 X:108801219-108801241 CAACCTGTGAAGCTGCAGCCTGG + Intergenic
1198514781 X:137394925-137394947 CGAACTATGAAACTACTACAAGG - Intergenic
1198696807 X:139349626-139349648 CACACTATGAAACTACTACAAGG - Intergenic
1199010687 X:142754883-142754905 TGAACTCTGAAACTACTGCCTGG + Intergenic
1199203242 X:145118175-145118197 CAAACTAGGAAACTACTACAAGG + Intergenic
1200435852 Y:3149394-3149416 CAAACTATGAAACTCCTGCAAGG - Intergenic
1200494584 Y:3865828-3865850 CAGCCTGTGAGACTACTGCTGGG - Intergenic
1200566177 Y:4771179-4771201 CAAACCATGAAACTACTGCAAGG - Intergenic
1200825169 Y:7630295-7630317 GAACCTATAAAACTTCTGCATGG + Intergenic
1201226939 Y:11827585-11827607 CAACCCATAAATCTGCTGCCTGG + Intergenic