ID: 1187659918

View in Genome Browser
Species Human (GRCh38)
Location X:21532830-21532852
Sequence AGGAGCTTATACTTTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187659913_1187659918 11 Left 1187659913 X:21532796-21532818 CCCTTTCCACTTTTCAAATTAAT 0: 1
1: 0
2: 5
3: 70
4: 803
Right 1187659918 X:21532830-21532852 AGGAGCTTATACTTTGAGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 180
1187659915_1187659918 5 Left 1187659915 X:21532802-21532824 CCACTTTTCAAATTAATAATTTT 0: 1
1: 1
2: 12
3: 134
4: 1323
Right 1187659918 X:21532830-21532852 AGGAGCTTATACTTTGAGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 180
1187659914_1187659918 10 Left 1187659914 X:21532797-21532819 CCTTTCCACTTTTCAAATTAATA 0: 1
1: 0
2: 4
3: 53
4: 486
Right 1187659918 X:21532830-21532852 AGGAGCTTATACTTTGAGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 180
1187659912_1187659918 14 Left 1187659912 X:21532793-21532815 CCTCCCTTTCCACTTTTCAAATT 0: 1
1: 0
2: 4
3: 58
4: 473
Right 1187659918 X:21532830-21532852 AGGAGCTTATACTTTGAGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187659918 Original CRISPR AGGAGCTTATACTTTGAGGA AGG Intronic
900282739 1:1881694-1881716 AAGAGCTTTTACCTTGAGGCCGG - Intronic
900934342 1:5755833-5755855 GGGATCTGACACTTTGAGGAGGG - Intergenic
901203727 1:7482195-7482217 TGGAGCTTATGCTTGAAGGATGG - Intronic
903455208 1:23482982-23483004 AGGAGCATCGACTTTGGGGAAGG - Intronic
903836129 1:26204284-26204306 AGGAGCTAACAGTTTGAGTATGG + Intergenic
906803327 1:48756407-48756429 AGGAGTTTAAAGTTTGATGAGGG - Intronic
907735576 1:57108554-57108576 AGGAGCTTACATTTTAATGAAGG - Intronic
909637314 1:77831036-77831058 AGGATCTTCGACTTTGTGGATGG - Intronic
910730959 1:90395460-90395482 AGAAGCCTATACTTTGAGGGTGG - Intergenic
912348774 1:108991236-108991258 AAGAGGTAATACTTTGGGGAAGG - Exonic
915731927 1:158060022-158060044 AGGAGCAGAGACTTGGAGGAAGG - Intronic
916372013 1:164108918-164108940 AGGACATTATACTATGAGTAGGG + Intergenic
917600702 1:176570960-176570982 AGCAGCTTGGACTTTCAGGAAGG - Intronic
919098266 1:193062255-193062277 TGGAGCTTAAGCTTTGAGGCAGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
921621628 1:217331914-217331936 AGGATGAAATACTTTGAGGACGG - Intergenic
921985361 1:221306357-221306379 TGGAGCTTATAGTTTGAGATAGG + Intergenic
1063135079 10:3209075-3209097 AGGTGGTTTTATTTTGAGGAGGG + Intergenic
1063605874 10:7522443-7522465 GGGAGCTTATACTCTGATGCGGG + Intergenic
1066367863 10:34793988-34794010 TAGAGCTTATCCTTTGAGTAAGG - Intronic
1068138175 10:52971689-52971711 AGAAACAGATACTTTGAGGAAGG - Intergenic
1070523184 10:77272312-77272334 AGGAACCTATACTTTAAGGAGGG - Intronic
1070568195 10:77619883-77619905 ATGAGCTAAGACTTGGAGGATGG + Intronic
1071315886 10:84397268-84397290 AGGACATTATACTTTGGGGGAGG - Intronic
1071480130 10:86058844-86058866 AGGAGCTTATAATTTAGGGGAGG + Intronic
1072095709 10:92177423-92177445 AGGACCTAATATTTTGAGAAAGG + Intronic
1072324212 10:94280803-94280825 AGGAGCAGATATTTGGAGGAGGG - Intronic
1078595534 11:12683347-12683369 GGGAGGTTATACATTGTGGATGG + Intronic
1079197219 11:18339948-18339970 AGGAATCTATACTTTTAGGATGG - Intronic
1079936156 11:26619042-26619064 AGGAGCTTATACTCTGATAATGG - Intronic
1081280054 11:41198485-41198507 TGCAGCTTTTGCTTTGAGGAGGG + Intronic
1083691393 11:64411065-64411087 TGGAGCTTATATTTTGGGGTAGG + Intergenic
1083911477 11:65712549-65712571 AGGCGCAGATACTTTGATGAAGG + Intronic
1086513599 11:87587518-87587540 ATGAGTTTATACTGTGAAGAAGG + Intergenic
1087482823 11:98722619-98722641 AGGAACTTATACATTGCTGATGG + Intergenic
1090338632 11:125994704-125994726 AAGAGCACATATTTTGAGGAGGG - Intronic
1093314543 12:17632052-17632074 TGGAGTTAATAATTTGAGGATGG - Intergenic
1093503100 12:19834912-19834934 AGGAGCTTCTAATTTGAGAAAGG + Intergenic
1099163564 12:79274739-79274761 AGGAGGTGACACTTTCAGGAGGG - Intronic
1099283720 12:80688236-80688258 AAGAAATTATACTTTGATGAAGG - Intergenic
1100514922 12:95318117-95318139 AGGAATTTAAACATTGAGGATGG - Intergenic
1102999577 12:117375177-117375199 AGGAGCTTATATTTTGCTGAAGG + Intronic
1105624336 13:22098573-22098595 AGGAGCTTTTGCATTGAAGATGG + Intergenic
1107279154 13:38713683-38713705 ATGAAATTATACTTTGGGGAAGG - Intronic
1107658600 13:42616411-42616433 AGGAAAGTATACTTGGAGGAGGG - Intergenic
1107706146 13:43108058-43108080 AGGAACTTATATGTAGAGGAAGG + Exonic
1108963253 13:56263748-56263770 AGGAGCCTATTATTAGAGGAAGG - Intergenic
1109885713 13:68541446-68541468 AGGAGCTAATACTTGCAGAAAGG - Intergenic
1110769425 13:79321872-79321894 AGGAGCTTATAATCTGAAAAGGG - Intronic
1111738385 13:92171396-92171418 AGGAGATTATACATTTAGGAAGG - Intronic
1112222597 13:97506201-97506223 AGGAACATATCCTTTGCGGATGG - Intergenic
1112921525 13:104618655-104618677 AGGAGCAAATACAATGAGGAAGG - Intergenic
1114287546 14:21259531-21259553 AGCAGATTATAGTTTGAGGGTGG - Intronic
1116990272 14:51268630-51268652 AGGAGTATATACTTTGATGAGGG + Intergenic
1119859335 14:77925074-77925096 AGGAGCTCCTACTTGGAAGATGG + Intronic
1120466133 14:84860104-84860126 TGCAGCTTATAATTTGAGGTAGG + Intergenic
1120737442 14:88069115-88069137 AGGAGCTTAAGCTCTGAAGATGG - Intergenic
1122799261 14:104221636-104221658 AGGAGCAGAGACTTTCAGGAAGG - Intergenic
1127222630 15:56896342-56896364 AGGTGCTTCTAATTAGAGGAGGG + Intronic
1127870249 15:63066584-63066606 AGGAAGTTATACATTGAGAAGGG + Intronic
1130334435 15:82947024-82947046 GGGAGCTTATATTTTGAAAAGGG - Intronic
1130929856 15:88416340-88416362 AGACTCTTAAACTTTGAGGAAGG + Intergenic
1135497253 16:22963423-22963445 ATGACCTTAGACTTTGTGGAAGG - Intergenic
1140098752 16:71896273-71896295 AACAGCATAAACTTTGAGGAGGG + Intronic
1142677451 17:1522758-1522780 AGGAGCTTATATTCTGGGGCAGG + Intronic
1143177625 17:4965532-4965554 AGGAGCTCATACTATGCTGAAGG - Intronic
1143889539 17:10092016-10092038 ATGGGATTTTACTTTGAGGAAGG - Intronic
1146113083 17:30109598-30109620 AGGAGCTTATATTTTGAGTGAGG + Intergenic
1149161395 17:53697782-53697804 TGTAGCTAATACTTTGAAGAAGG - Intergenic
1154426022 18:14272597-14272619 TGGTGCTTAAACATTGAGGAAGG - Intergenic
1157705901 18:49806093-49806115 AAGAGTTGATACTTAGAGGAAGG + Intronic
1162095180 19:8306041-8306063 AGGAGCTGACACATTTAGGATGG - Intronic
1165583743 19:36893893-36893915 AGGAGTTTAGATTTTCAGGAGGG - Intronic
1165748284 19:38244142-38244164 AGGAGCTAATATTCTGAAGATGG + Intronic
1166094667 19:40531168-40531190 AGGGGGCTTTACTTTGAGGATGG + Intronic
929448771 2:42022309-42022331 AGGAGCTAAAATCTTGAGGACGG - Intergenic
930508029 2:52309000-52309022 GGGAACTTATACTCTTAGGAAGG - Intergenic
931821137 2:65953627-65953649 TGGAGATGATACTCTGAGGAAGG - Intergenic
932599018 2:73111706-73111728 AGGAGCTTCTAAGTTAAGGAAGG - Intronic
933016391 2:77132729-77132751 AGGAGCTGATTCATTGATGAAGG - Intronic
934561056 2:95313476-95313498 AGGAGCTTCTAGGCTGAGGATGG - Intronic
936476540 2:112844726-112844748 AGGAGCCTTTCCTCTGAGGAGGG - Intergenic
937630808 2:124099103-124099125 TGGAGCTTACAGTGTGAGGATGG - Intronic
940467350 2:154048048-154048070 AGTAGCTTCTACTTCTAGGAAGG + Intronic
940483911 2:154273859-154273881 AAGAGATTATATTTTGATGAAGG + Intronic
941568830 2:167143224-167143246 AGTAGCTTATAGTTTAAGAAAGG + Intronic
941725435 2:168855091-168855113 AGCAGATTGTTCTTTGAGGATGG - Intronic
942405531 2:175650005-175650027 AGGTGCATATACATTTAGGATGG - Intergenic
942668719 2:178350752-178350774 AGTAACTTCTACTTTGGGGAAGG + Intronic
947884651 2:233557672-233557694 AGGAGCTGAGGCTTTAAGGAGGG + Intronic
1169373872 20:5050398-5050420 GGGAGCTTATTCTTAGAGAAGGG - Intergenic
1170458576 20:16555520-16555542 ATGAGCTTTTCCTTGGAGGATGG - Intronic
1174895303 20:54442899-54442921 TGGCACTCATACTTTGAGGATGG + Intergenic
1174901800 20:54508452-54508474 AGGAGCTTATATCTGGAGGGTGG + Intronic
1175686266 20:61030962-61030984 AGGAGGTGATACCTTTAGGATGG - Intergenic
1176846006 21:13877242-13877264 TGGTGCTTAAACATTGAGGAAGG + Intergenic
1179048908 21:37871794-37871816 AGGTGGTTATACTTTGTGAATGG - Intronic
1181184458 22:21092830-21092852 AGGAGCTTATAGTTTCACGAGGG - Intergenic
1182891357 22:33821397-33821419 AGGAGTTTATCATTTCAGGATGG - Intronic
1184578176 22:45391803-45391825 AGGTTCTTCTACTTTGAGGGAGG + Intronic
949089945 3:15279-15301 AGTGGCTTAGACTGTGAGGATGG - Intergenic
949455480 3:4233837-4233859 TGGTGCTGTTACTTTGAGGAAGG - Intronic
949596642 3:5554848-5554870 AGGAGCTGATATTTTTAAGATGG - Intergenic
951383615 3:22016809-22016831 AGGAGCTTGAACTGTAAGGATGG - Intronic
954188125 3:48935844-48935866 AGGAGCCTACACATTGAGGATGG + Intronic
955857481 3:63288825-63288847 AGGTGCTGTTTCTTTGAGGAGGG + Intronic
955873074 3:63460440-63460462 AGGAGGTTATAGTTTGATGGAGG - Intronic
960298727 3:115975559-115975581 GGGAGATTATAGTTTGGGGATGG + Intronic
960925600 3:122792912-122792934 AGGAGCGAATAGTTTGAGGTCGG - Intronic
961028694 3:123584322-123584344 ATGAGTTTAGACTTTTAGGATGG - Intronic
964811258 3:160667272-160667294 AGGAGCTAATACTTTAAGCTGGG + Intergenic
965388831 3:168079381-168079403 TGGTGCTTATTCTTTGAGGTTGG + Intronic
965572928 3:170189690-170189712 ATGCGGTTATACTTTGAAGATGG - Intergenic
965614131 3:170575877-170575899 AGGGGCTTATCCTTTGAACAGGG - Intronic
970018116 4:11535457-11535479 TGGAGCTGATCCTTTGGGGAAGG + Intergenic
970135855 4:12923011-12923033 AGCAGCTGATAATTTGAGGATGG - Intergenic
975788773 4:77924382-77924404 AAGAGCTTATTTTTGGAGGAGGG + Intronic
978151615 4:105442647-105442669 GGAAGCTCAAACTTTGAGGAAGG + Intronic
978558200 4:110003649-110003671 AGGGGCTACTGCTTTGAGGATGG + Intronic
978889587 4:113807897-113807919 AGGAGTATATTCTCTGAGGAAGG + Intergenic
984125420 4:175803280-175803302 AGGAATTTGTACTTTGAGAATGG + Intronic
985701857 5:1378262-1378284 AGGAGCTTGTAGTTTCAGCACGG - Intergenic
986253721 5:6083973-6083995 TGGAGCTTACACTTTAAAGAAGG - Intergenic
986599588 5:9458449-9458471 AGCAGCTTAAAGTTTGATGAAGG - Intronic
989658172 5:43767879-43767901 TGGAGCTTATATTTTAATGAGGG + Intergenic
990064035 5:51689995-51690017 TAGAGGTTATAATTTGAGGAAGG - Intergenic
990072626 5:51803669-51803691 AGGTGCTGATACTTTGGAGACGG + Intergenic
991076781 5:62548672-62548694 AGAATCTTATACTTTTGGGAAGG - Intronic
992139669 5:73783083-73783105 AGGGGCTTACAGTTTGAGGTTGG + Intronic
994134925 5:96274984-96275006 AACAATTTATACTTTGAGGAAGG + Intergenic
995547096 5:113243742-113243764 AGGAGCTCAGGCCTTGAGGACGG + Intronic
996168552 5:120259417-120259439 AGGATCTTAGAGTTTGTGGAAGG + Intergenic
996628954 5:125605005-125605027 AGGGGCTTAGACTTAGTGGAGGG - Intergenic
997441868 5:133914239-133914261 AGGATCTTTTACCTTGGGGAAGG + Intergenic
999608338 5:153341352-153341374 GGGAGCTTATTCTTTGAGGAAGG + Intergenic
999800420 5:155028147-155028169 AGGAGCTTCTGCATTCAGGAAGG + Intergenic
1000544097 5:162577789-162577811 TGGAGCTTGTGCTTTGAGAAAGG + Intergenic
1001311116 5:170611674-170611696 AAGAGGTTACCCTTTGAGGAAGG - Intronic
1001609814 5:172991335-172991357 AGGAGCTGATACGTTAATGAGGG + Intronic
1002386616 5:178871842-178871864 AGGAGATTAGATTTGGAGGATGG + Intronic
1003464234 6:6363173-6363195 AGGAGCTGATAATGTGATGAAGG + Intergenic
1004040941 6:11974891-11974913 ATGAGCTTACACTCTGATGATGG + Intergenic
1005551563 6:26922959-26922981 AGGAGCAAACACTTTGGGGATGG + Intergenic
1007965881 6:46003382-46003404 AGAACCTTATACTTTGAGGATGG + Intronic
1008403273 6:51089483-51089505 AGGAACTTATATTGTAAGGATGG - Intergenic
1010734998 6:79434187-79434209 AGGAACTTAAGCTTTGAGGTAGG - Intergenic
1014597289 6:123360600-123360622 AGGAGCTTAGTCTTTGTGGAAGG + Intronic
1017549066 6:155484679-155484701 AGAAGCTTATAATTTGGGGTAGG + Intergenic
1022888612 7:34673239-34673261 AGGAGCTTATAGTCTGATGGTGG - Intronic
1022891788 7:34708576-34708598 TGGAGCTTATAGTTAGAGGAAGG + Intronic
1023202859 7:37717755-37717777 AGGAGCTTATAATTTAGTGAAGG - Intronic
1024657410 7:51463194-51463216 TGGAGCATCTACTTTGAGGCAGG - Intergenic
1027152268 7:75740967-75740989 AGGAGCTTGTATTGTGGGGATGG + Intergenic
1028476619 7:91260745-91260767 TGTTGCTTAAACTTTGAGGAAGG - Intergenic
1029360579 7:100085783-100085805 AGGAGCTTACACTTTGGGTGGGG + Intergenic
1032620895 7:133530616-133530638 AGGAGATTAGCGTTTGAGGATGG - Intronic
1033025068 7:137764318-137764340 AGGAACTTTTACATTGAGAAAGG + Intronic
1035013341 7:155740531-155740553 AGGAGCTTATACTCAGTCGAGGG + Intronic
1035477038 7:159151153-159151175 AGGAGCTGATCCTTGGAGTAAGG - Intergenic
1037315800 8:17598363-17598385 AGGGGTTTATTCTTTCAGGAGGG - Intronic
1038468180 8:27785956-27785978 AGGAGGTTATGGTTAGAGGAGGG + Intronic
1041184721 8:55287066-55287088 AGAAAGTTATACTTTGAGGTTGG + Intronic
1042354365 8:67810060-67810082 AGGAGCCTGGACTCTGAGGAAGG - Intergenic
1045704744 8:104909049-104909071 AATAGCATATACTTTGATGATGG + Intronic
1045866424 8:106871032-106871054 AAGAGCTAATGCTTTCAGGAAGG - Intergenic
1046011670 8:108556041-108556063 AGGAGCGTATCCTTTGGGAAGGG + Intergenic
1046520686 8:115321190-115321212 AGGAGCTTGTATTTTGGGGGGGG - Intergenic
1046798109 8:118394417-118394439 AAGAGCTTGTAATTTGAGGAGGG - Intronic
1047460467 8:125059121-125059143 AGGATTTTATCCTTTTAGGAAGG - Intronic
1048718192 8:137291999-137292021 AGGAGCTTATATTCTATGGAAGG - Intergenic
1049873777 8:145002360-145002382 AGGAGCTTCTGTTTTGGGGAAGG - Intergenic
1052330217 9:27260056-27260078 AGAAGCTTATTTTTTGAAGATGG + Intergenic
1052746149 9:32443093-32443115 AGAAGCTTATAATTTGGGGTAGG + Intronic
1052995926 9:34551670-34551692 AGGAGCTTATAATCTGATGGTGG + Exonic
1053047591 9:34932947-34932969 TGAAGCTTATACTGTGGGGAGGG - Intergenic
1057570194 9:96198501-96198523 TGGAGCTTATACTCTAATGAAGG + Intergenic
1058181538 9:101806301-101806323 TGGAGATTATAATGTGAGGATGG + Intergenic
1059516930 9:114904649-114904671 AGGAGCTTATAGTCTGAAAAGGG - Intronic
1059551507 9:115233846-115233868 AGGAGCTATTAATTTGAGAATGG - Intronic
1060987131 9:127826176-127826198 TGGAGCTGATACTGTGATGAGGG - Intronic
1061695363 9:132369280-132369302 TGGAGCTTATATTCTGAGGCAGG + Intergenic
1061786610 9:133032454-133032476 AGGAAGTTAGACTTTGAAGATGG + Intronic
1061787390 9:133038152-133038174 AGGAAGTTAGACTTTGAAGATGG + Intronic
1186571973 X:10724446-10724468 AGGAGCTTATAATCTAAGAAAGG + Intronic
1187659918 X:21532830-21532852 AGGAGCTTATACTTTGAGGAAGG + Intronic
1188228114 X:27626972-27626994 AGCAGCTTATAATTAGGGGAGGG + Intronic
1189399290 X:40651010-40651032 AGGAACTTAGTCTTTGAGAAGGG - Exonic
1189618220 X:42807491-42807513 AGAAGCTTTTACTATGAGAAAGG - Intergenic
1191213533 X:57912609-57912631 TGGAGTTTCTATTTTGAGGAAGG + Intergenic
1194266716 X:91762634-91762656 AGGAGCTTATATTTGGAGACAGG - Intergenic
1194668187 X:96698605-96698627 AGGGGCTTTTTCTTTGGGGAAGG - Intronic
1194934772 X:99935804-99935826 AGGTGCATATATTTTTAGGATGG + Intergenic
1197538840 X:127728861-127728883 AGGAGGTTATACTTCCAGTATGG - Intergenic
1197868831 X:131046625-131046647 TGGAGCTTTTACTATAAGGAAGG - Intergenic
1198574670 X:137996893-137996915 AGGAGTTTATAATCTAAGGAGGG + Intergenic
1200583916 Y:4983546-4983568 AGGAGCTTATATTTGGAGACAGG - Intergenic