ID: 1187660967

View in Genome Browser
Species Human (GRCh38)
Location X:21545809-21545831
Sequence TCCCTCTGGTGCAGGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7586
Summary {0: 1, 1: 33, 2: 517, 3: 1280, 4: 5755}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187660967_1187660972 13 Left 1187660967 X:21545809-21545831 CCAGCAGACCTGCACCAGAGGGA 0: 1
1: 33
2: 517
3: 1280
4: 5755
Right 1187660972 X:21545845-21545867 AGGAAAACTAACAAACAGAAAGG 0: 5634
1: 2408
2: 568
3: 212
4: 926
1187660967_1187660970 -7 Left 1187660967 X:21545809-21545831 CCAGCAGACCTGCACCAGAGGGA 0: 1
1: 33
2: 517
3: 1280
4: 5755
Right 1187660970 X:21545825-21545847 AGAGGGACCTGACTGTTAGAAGG 0: 47
1: 849
2: 2362
3: 4177
4: 1527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187660967 Original CRISPR TCCCTCTGGTGCAGGTCTGC TGG (reversed) Intronic
Too many off-targets to display for this crispr