ID: 1187665381

View in Genome Browser
Species Human (GRCh38)
Location X:21602983-21603005
Sequence CTAAAATCAAGATGAAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187665381_1187665382 -3 Left 1187665381 X:21602983-21603005 CCTGAGCTTCATCTTGATTTTAG 0: 1
1: 0
2: 2
3: 22
4: 221
Right 1187665382 X:21603003-21603025 TAGTGAACTTCCTTTGTACTTGG 0: 1
1: 0
2: 2
3: 9
4: 159
1187665381_1187665384 23 Left 1187665381 X:21602983-21603005 CCTGAGCTTCATCTTGATTTTAG 0: 1
1: 0
2: 2
3: 22
4: 221
Right 1187665384 X:21603029-21603051 TATATAGCCAAATTTTATTATGG 0: 1
1: 0
2: 6
3: 34
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187665381 Original CRISPR CTAAAATCAAGATGAAGCTC AGG (reversed) Intronic
902173717 1:14633522-14633544 CTAAAATCAAGATGCAGACAGGG - Intronic
902904868 1:19548944-19548966 ATATAATCAAGAGGAAGCTGTGG + Intergenic
903037956 1:20506924-20506946 ATAAAATCAAGATGAAAATGTGG + Intronic
905903774 1:41601805-41601827 CTAAAATCAGGAAGAAGCTAAGG - Intronic
908348539 1:63261058-63261080 CTAAAATCATGTTGAAGCTTTGG + Intergenic
912775760 1:112505528-112505550 ATAAAATGAAGATGCAGGTCAGG + Intronic
913420464 1:118661751-118661773 TTAAAAGCAAAATGAAGCTAGGG + Intergenic
915302613 1:154959962-154959984 CTAAAATCAATATGGACCACAGG + Intronic
915806598 1:158859878-158859900 ATAAAATCAAGATGAAATTCTGG + Intergenic
916656342 1:166879051-166879073 CTGACTTCAAGATGAAGCTGTGG - Intergenic
918013863 1:180613721-180613743 ATAAAATCAACATGAAGGGCAGG - Intergenic
918888064 1:190223037-190223059 CTTCCATCAAAATGAAGCTCAGG + Intronic
919334494 1:196214616-196214638 GGAAATTCAAGATGAATCTCAGG + Intergenic
919355963 1:196521974-196521996 ATAAAATAAAGATGAATGTCAGG + Intronic
920490990 1:206415261-206415283 CTAAATACAAGATGAAGTTTTGG - Intronic
921223073 1:212988015-212988037 ATAAAATCAAGGTGAATCTTAGG - Intronic
921419942 1:214934728-214934750 CTAAAATAAGGAAGAAGCTTAGG - Intergenic
921688542 1:218120101-218120123 CTACAATCCAGATGAATCTTGGG + Intergenic
924469461 1:244327955-244327977 CTACAATCAAGAACAAGTTCAGG - Intergenic
1063066155 10:2611376-2611398 CTCAACACAATATGAAGCTCAGG - Intergenic
1064638146 10:17389393-17389415 CATAAAGCAAGATGAAACTCGGG + Intronic
1067458939 10:46443293-46443315 CTTTAATAAAGATGAAGCTAAGG + Intergenic
1067628257 10:47941339-47941361 CTTTAATAAAGATGAAGCTAAGG - Intergenic
1068344759 10:55761095-55761117 CTAAAAGGAAAATAAAGCTCTGG + Intergenic
1068403667 10:56563080-56563102 TAAAACACAAGATGAAGCTCTGG + Intergenic
1071828187 10:89346610-89346632 TTATAATCAAGAGGGAGCTCAGG - Intronic
1073383809 10:103104740-103104762 CTCAAATCTAAAGGAAGCTCTGG + Intronic
1073776862 10:106796258-106796280 CTAAAATCAAGGTAAACCTAGGG + Intronic
1075011023 10:118870283-118870305 CTAAAATGAAGTGGATGCTCTGG + Intergenic
1079170086 11:18085125-18085147 CTAAAATCAGGAAGAAGGTAAGG + Intronic
1084748483 11:71188629-71188651 CCAAAGTCAAGATGAAACTGAGG + Intronic
1089747167 11:120625482-120625504 CCTAAACCAAAATGAAGCTCAGG - Intronic
1090260658 11:125316395-125316417 TGAAATTCAAGATGAAGCTAGGG - Intronic
1092941050 12:13407510-13407532 CTGAAGTCAAGATGAAGCAGGGG + Intergenic
1093100290 12:15020171-15020193 CTAAATCCAAGATGATGCTGGGG + Intergenic
1093963911 12:25304737-25304759 CTAAAGTCAAGATGAAGGAAAGG + Intergenic
1095807978 12:46342296-46342318 TTAAAATCAAGAAGAAACTCTGG - Intergenic
1097103575 12:56606678-56606700 CTAAAAGCAAGAAGAAGATGAGG - Exonic
1098931554 12:76421946-76421968 CTAACAACAAGAGGAAGCTAAGG + Intronic
1099480684 12:83162143-83162165 CTAAAATTGAGATTAAGATCTGG - Intergenic
1100703015 12:97167811-97167833 CTACACACATGATGAAGCTCTGG + Intergenic
1102664419 12:114558180-114558202 CTAACATTCAGACGAAGCTCAGG + Intergenic
1104369531 12:128211491-128211513 CTAAAATCAAGATGGTGCAACGG + Intergenic
1105952055 13:25238049-25238071 CTAAGATCAAGAAGAAGATAAGG + Intergenic
1106970908 13:35140583-35140605 CTAAACTCAAAAGGAAGCTAGGG - Intronic
1107168246 13:37308784-37308806 CTACAATCAGAATGAATCTCAGG + Intergenic
1107212730 13:37876763-37876785 CTATAATCAATAGGAAGGTCTGG - Intergenic
1108119570 13:47169889-47169911 GTAACATCAAGATGAGGCACTGG - Intergenic
1110597800 13:77338211-77338233 CTAAAATCAAGATGTAAATAAGG - Intergenic
1110918049 13:81047969-81047991 CTTACATCAAGATGAAGCAATGG + Intergenic
1112797664 13:103074094-103074116 TTAAAATCATTATGAAGCTCAGG - Intergenic
1112921945 13:104624927-104624949 CTAAAATTACCATGAAGCTGAGG - Intergenic
1113721317 13:112559831-112559853 CTAAAGTCAAGATGCAGGTCTGG + Intronic
1117989696 14:61421592-61421614 CTACAATGAATATGAAGGTCTGG - Intronic
1118142197 14:63096485-63096507 CTAGATTCAAGATAAGGCTCCGG - Intronic
1118750548 14:68804936-68804958 CTAAAATCAGGAACAAGGTCAGG - Intergenic
1122173028 14:99892590-99892612 CTAAAATCAAAATGCAGCCAGGG - Intronic
1122380262 14:101298696-101298718 CAAAAATCAAGCTGAAGCTCAGG + Intergenic
1126271317 15:46820542-46820564 TTAAAATCAAACTGAAGTTCAGG - Intergenic
1129928933 15:79392532-79392554 CTAAAATTAAGATGAAGGAAAGG - Intronic
1130069088 15:80631260-80631282 CTAAAAACAATCAGAAGCTCTGG - Intergenic
1131988467 15:98068339-98068361 CTAAAATCATGAGAAACCTCAGG + Intergenic
1132978533 16:2722342-2722364 CAAAAGTCAAGATGCAGATCAGG + Intergenic
1133677465 16:8088393-8088415 CTAGAACCATAATGAAGCTCTGG - Intergenic
1134869436 16:17638457-17638479 CTAAATTCAAGATGAGGTTTGGG + Intergenic
1141588820 16:85053599-85053621 ATAAAATAAAGATGAATCTTAGG - Intronic
1144047820 17:11469409-11469431 CTAAAATCAAGGTGATACTGGGG - Intronic
1146087588 17:29844446-29844468 CTAAAAGGAGGAAGAAGCTCTGG - Intronic
1147395067 17:40136167-40136189 CTGAAATCAAGAAGAAACTGAGG - Intronic
1149488557 17:57064951-57064973 CTAAAATCAAGATGGTGGTCAGG + Intergenic
1151406833 17:73893189-73893211 CTAAAATCAAGATGTTTCCCAGG - Intergenic
1153304005 18:3616018-3616040 CTCAAATCATAATGAAGCCCAGG + Intronic
1156814579 18:41294462-41294484 CTATAATCAAGGTGATGTTCTGG + Intergenic
1157664462 18:49474109-49474131 CTAAAATCAGGATGCAGGCCAGG - Intergenic
1158451943 18:57574577-57574599 CTAAAATCCAGATCAAGCTCCGG + Intronic
1159268625 18:66119087-66119109 CTAAAATAAAAATGAAGTTATGG + Intergenic
1159405106 18:67991587-67991609 CTTAAAAGAACATGAAGCTCTGG + Intergenic
1159724017 18:71930906-71930928 CTAAAACCAAGAGGAATCCCTGG - Intergenic
1160352383 18:78194693-78194715 GTGGAATCAACATGAAGCTCAGG - Intergenic
1163057526 19:14731763-14731785 AGAAAATAAAGATTAAGCTCTGG - Intronic
1164144373 19:22502443-22502465 CTGAGAGCAAGATGGAGCTCAGG - Intronic
1164144438 19:22503151-22503173 ATCAGAGCAAGATGAAGCTCTGG - Intronic
1165610582 19:37148553-37148575 CCACAATCAAGATGAAGAACAGG - Exonic
1165691937 19:37870378-37870400 ATAAAATCAAGCTGCAGCCCGGG - Intergenic
1166645866 19:44531216-44531238 CTAAAATGGAGATGATGCCCAGG + Intergenic
927567838 2:24129104-24129126 CTACAAGAAAGATGGAGCTCTGG - Intronic
927909762 2:26888900-26888922 CCAAGATCAAGTTGAAGCTGAGG + Intronic
929477333 2:42264587-42264609 CTATAATCTAGATAAATCTCTGG - Intronic
929488958 2:42379616-42379638 CTAAAGTCAACATGAAGCCATGG + Intronic
931363742 2:61600676-61600698 CTAAAATCAAGATGTTGGTAGGG - Intergenic
931401744 2:61937669-61937691 CTAAAAACAAGATTGAGCTATGG - Intronic
931800216 2:65750756-65750778 CTAAAATCAAGATGTTGGTAAGG + Intergenic
931993696 2:67818898-67818920 CTAAAATCAGGAACAAGGTCAGG + Intergenic
935520961 2:104104633-104104655 CTACAATCAAGATAAAGTTAGGG - Intergenic
939221254 2:139304126-139304148 CTTACATAAAGATGCAGCTCAGG + Intergenic
939320846 2:140619476-140619498 CTCAAAACCAGATGAAACTCAGG + Intronic
939459257 2:142478119-142478141 CTTAAATCTAGATGAAGAACTGG + Intergenic
940827365 2:158428030-158428052 CTAAAATCAATAAGAATCTATGG + Intronic
943197821 2:184778083-184778105 CTAGAATCAAGCTGAAGCAAAGG - Intronic
943255079 2:185584278-185584300 TTAAAATCAAGCTGAAATTCTGG + Intergenic
946945833 2:224821212-224821234 CAAGAATCAAGAAGAACCTCTGG - Intronic
947223071 2:227813225-227813247 ATTAAATCAAGGTGAAGCTGAGG + Intergenic
947346437 2:229194603-229194625 CTAGAGTTAATATGAAGCTCAGG - Intronic
948202247 2:236137521-236137543 TTAAAATCAAGTTTAATCTCAGG - Intergenic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
948576878 2:238957856-238957878 CTAAAGTCAAGATGAAGGCAAGG + Intergenic
949029348 2:241783987-241784009 CTAAATTCAAGCTGTAGCTATGG + Intronic
1170372619 20:15665921-15665943 ACAAAATAAAGATGAAGATCTGG - Intronic
1170979310 20:21196150-21196172 TTAAATTCAATATGAAACTCTGG - Intronic
1172851276 20:37967862-37967884 CTAAAGTCAAGATGAAGAAAAGG - Intergenic
1173352416 20:42257199-42257221 CTAAAATCAAGCTGCAGTTCTGG - Intronic
1174689813 20:52492780-52492802 TTAAACACAAGATGAAGGTCCGG - Intergenic
1175665499 20:60855227-60855249 CTAAGAACAAGATGGAACTCTGG - Intergenic
1177383203 21:20372179-20372201 CTAAAATCAAGGTGTAGGTAAGG - Intergenic
1178711925 21:34924818-34924840 CTAAGATTAAGATTCAGCTCTGG + Intronic
1179804069 21:43826120-43826142 CTAACCTCCAGGTGAAGCTCCGG - Intergenic
1183852923 22:40606906-40606928 CAAAAATCATTATCAAGCTCAGG + Intronic
1185179212 22:49349614-49349636 CTAAGCTCCACATGAAGCTCTGG - Intergenic
949777214 3:7646672-7646694 CCAAAATCACCATGAAGCACAGG - Intronic
952006683 3:28849335-28849357 CTGAAATCAGGTTGTAGCTCTGG + Intergenic
954236890 3:49263850-49263872 CCAGAAACAAGATGAGGCTCAGG - Intergenic
958439735 3:94141685-94141707 CTAAAATCAAGATGTAAATTGGG + Intergenic
958609119 3:96401518-96401540 CTAAAATCAAGGTGATGATAGGG + Intergenic
959102611 3:102029919-102029941 CTAAAATCAAGATGTCACCCAGG - Intergenic
959527460 3:107393480-107393502 CTAAAATCTAAAAGAAGTTCTGG + Intergenic
959590644 3:108076081-108076103 CTAAAATCAAGGTGTTGCCCAGG - Intronic
960545436 3:118908918-118908940 CTAAAATATAGATGAAGAACAGG - Intronic
962054629 3:131857544-131857566 CTAAAATGAAAATAAGGCTCAGG - Intronic
963119731 3:141765827-141765849 CTAAAATCCACACAAAGCTCTGG - Intergenic
963236265 3:142960367-142960389 ATAAAATCAAGATGCACCTGTGG + Intronic
964836604 3:160946155-160946177 GTAAAATTGAGATGAAGCTAGGG - Intronic
971430574 4:26562223-26562245 CTAAAATCAGAATGAAACTGGGG - Intergenic
971926770 4:33021081-33021103 TTGAAATCATGTTGAAGCTCTGG + Intergenic
973110710 4:46394144-46394166 CTAAAACAAAGATAAAACTCTGG + Intronic
973230531 4:47835680-47835702 CTGAAATCCACATGAAGCTATGG + Intronic
973631343 4:52823832-52823854 CTAAAATCAAGATGGTGGGCAGG + Intergenic
974218954 4:58940573-58940595 CTACATTCAAGATACAGCTCTGG + Intergenic
974881234 4:67759870-67759892 TTAAAACAAAGATGAAGCTTGGG + Intergenic
975773890 4:77761698-77761720 CTAAAATCAAGAACAAGGTAAGG + Intronic
975947150 4:79720680-79720702 CTAAAATTTAGATGAAACCCTGG - Intergenic
975978162 4:80122942-80122964 CTAAAATCTGGAACAAGCTCAGG - Intronic
977278385 4:95007703-95007725 GAAAAATCAAGATGAAGTTAAGG + Intronic
979616052 4:122744293-122744315 ATAAAACCAACATGAAGCTCTGG - Exonic
979616450 4:122747982-122748004 CACAAATCAACATGAAGCTCTGG - Intergenic
979922787 4:126522584-126522606 ATATAATAAAGATGAAGCTCAGG + Intergenic
980055755 4:128077973-128077995 CTAAAATCAAAATAAAGATATGG - Intronic
981975217 4:150720057-150720079 CAAAAATCAAACTGTAGCTCAGG + Intronic
982772462 4:159409892-159409914 GGAAAATCAGGATGAAGCACGGG - Intergenic
983610741 4:169642377-169642399 CTAATATTAAGATAAATCTCCGG + Intronic
984347770 4:178553010-178553032 CTAAAATGATTATAAAGCTCTGG - Intergenic
985262174 4:188125151-188125173 CTAAACTAGAGATGAAGTTCTGG - Intergenic
986114793 5:4762332-4762354 CTAAAGACAAGATGAAGCACAGG + Intergenic
986976166 5:13396904-13396926 CTACAATCAGTATGAAGCTGTGG - Intergenic
991247082 5:64520015-64520037 CTAAAATCCAGAGACAGCTCTGG - Intronic
991526061 5:67559181-67559203 GTAAAATCAAGGTGAACCCCAGG + Intergenic
991606440 5:68406574-68406596 CTAAAATTAAGATAAAGCCAGGG + Intergenic
991937049 5:71812278-71812300 ATTAAATCACGATGAAGCTTTGG + Intergenic
992287033 5:75246642-75246664 CTAAAATCAAGATGTGGATGGGG + Intergenic
993246719 5:85460526-85460548 CTAAAAATAATATGAAGCACAGG - Intergenic
993854292 5:93054147-93054169 CTGTCATCTAGATGAAGCTCTGG - Intergenic
995699077 5:114913609-114913631 CTAAACTCAAGATGAAGAAAAGG + Intergenic
998012336 5:138705265-138705287 ATAAAATCATGAGAAAGCTCAGG - Intronic
999056167 5:148579595-148579617 CTAAAATTAAGATGTAGGTAGGG + Intronic
999099172 5:149008368-149008390 CTAAAATGTAAATGAAGGTCAGG - Intronic
1000271750 5:159691589-159691611 CTAAAATTAATATGAAACTATGG + Intergenic
1000693715 5:164354023-164354045 ATAAAATCAAACTGAAGCTGTGG - Intergenic
1001049974 5:168406231-168406253 CTACAAACTGGATGAAGCTCAGG + Exonic
1004966356 6:20856172-20856194 CTAAAATACAGATGAAGCAATGG - Intronic
1004989984 6:21125946-21125968 CTAAAGTCTATATGCAGCTCTGG + Intronic
1005056761 6:21736689-21736711 CAAGCTTCAAGATGAAGCTCTGG - Intergenic
1005372423 6:25148874-25148896 CTAAAATCAAGAAGAAGATAAGG + Intergenic
1008242665 6:49130801-49130823 CTAAAATTAAGATGAAATTTGGG - Intergenic
1008692659 6:53998507-53998529 ATAAAAGCAAGAGGAAGCTATGG + Intronic
1009311310 6:62156417-62156439 CTAAAAGCAAGATGAAGTAATGG + Intronic
1009583582 6:65567926-65567948 CTGAACTGAAGATGAAGCTCAGG + Intronic
1009781831 6:68281062-68281084 TTAAAATCAAGAAGAAATTCTGG + Intergenic
1010471429 6:76233010-76233032 ATAAAATAAATATGAAACTCAGG + Intergenic
1010964604 6:82189794-82189816 CTAAGCTCATGATGAAGCTTTGG - Intronic
1011240185 6:85263948-85263970 CTAATATCTAGAAGAAGTTCAGG + Intergenic
1011268321 6:85549810-85549832 CTCAAAGCAACATGAAGCTCTGG + Exonic
1011721555 6:90162077-90162099 CAAAAATCGTGAAGAAGCTCTGG - Intronic
1012633666 6:101507598-101507620 CTAAAATAAAGATGAATTACAGG + Intronic
1012839834 6:104316248-104316270 CTAAAATAAATATGAAGCTGAGG + Intergenic
1013537157 6:111073723-111073745 GTAAACTCAAGATGAACCTATGG - Intergenic
1013867125 6:114712005-114712027 CAGAAATCAAGATGAATATCTGG + Intergenic
1014023149 6:116614475-116614497 TCAAAGTCAAGATAAAGCTCTGG + Intergenic
1014168472 6:118252054-118252076 CTAAATTCAAGATGAAGATGGGG + Intronic
1014286621 6:119506009-119506031 CTCAAATCAAAATGAAGATTTGG - Intergenic
1015363789 6:132374195-132374217 CTAAAATCAAGATGAATAGGTGG - Intronic
1015424706 6:133052331-133052353 TTAAAATGAAGATGAAGGTAAGG + Intergenic
1016076367 6:139801270-139801292 ATAAACCCAAGATGAAGCTCAGG + Intergenic
1016757246 6:147700341-147700363 CTATGATCAAGATTAATCTCAGG - Intronic
1017013862 6:150084288-150084310 CTAAAGGCAGGATGGAGCTCAGG + Intergenic
1019455490 7:1124813-1124835 CGAAATTCAAGGTGAGGCTCAGG + Intronic
1020347991 7:7185461-7185483 CTGAAATCAAGATGTAGGTATGG + Intronic
1023414594 7:39920149-39920171 CTAAGAGTCAGATGAAGCTCTGG - Intergenic
1024513888 7:50226887-50226909 ATAAAAGCAAAATGAAGCCCAGG + Intergenic
1026316191 7:69229756-69229778 CTAAAGTCTAGTGGAAGCTCTGG - Intergenic
1026876792 7:73883978-73884000 CTAAGATCAGGCTGAACCTCAGG - Intergenic
1027691554 7:81353305-81353327 CTAAAGTCAAGATGAAGGAAAGG - Intergenic
1029284936 7:99458914-99458936 GGAAAATCAAGATGAAGCCAGGG - Intronic
1029633707 7:101769681-101769703 CTAAAGACAAGATGAAGATGAGG - Intergenic
1030761173 7:113353807-113353829 CTAAAATCAAGATGTTGGTAGGG - Intergenic
1031918017 7:127581359-127581381 CTAAGATCAAGCTGGTGCTCAGG + Exonic
1033044417 7:137948362-137948384 CTACTAGCAAGATGAAGCTTAGG - Intronic
1034926747 7:155128933-155128955 ATAAAATAAACATGAAGCTGGGG + Intergenic
1036086399 8:5617551-5617573 CTGATCTCAAGATGCAGCTCTGG + Intergenic
1036473555 8:9072717-9072739 CACATGTCAAGATGAAGCTCTGG - Intronic
1041246777 8:55895867-55895889 CCAAAATCAAGAAAAGGCTCGGG - Intronic
1041318859 8:56593222-56593244 CTAAAAACAAGTTGAAGCAGTGG - Intergenic
1042480699 8:69298910-69298932 CTATAATGAGGATGAAGCCCTGG + Intergenic
1043078856 8:75739047-75739069 ATAAAAGTAAGATGAAGATCAGG + Intergenic
1043501402 8:80861140-80861162 GTAAACTCAAGATAAAGCTTTGG - Intronic
1046588181 8:116173773-116173795 CTAAAATCAGGATAAAGAACTGG - Intergenic
1050113750 9:2242253-2242275 CTGAAATGAAGATGTACCTCTGG + Intergenic
1050906756 9:11014968-11014990 TTGAAATCAAGAAGAAACTCTGG - Intergenic
1051685341 9:19652619-19652641 CTAAAATCAAGATGTTGGTTGGG - Intronic
1052081288 9:24209077-24209099 CTAAAATTAACAGGAAGGTCAGG - Intergenic
1052138687 9:24949335-24949357 CCAAGATCAAGATGATGCCCAGG + Intergenic
1052274073 9:26658468-26658490 CTAAAATCAACAAGCATCTCAGG + Intergenic
1052534436 9:29729509-29729531 TTAAAGTCAAGAAGAAGCTAAGG + Intergenic
1056106184 9:83349022-83349044 CTTAACTCTAGATGAGGCTCTGG - Intronic
1056949449 9:91030401-91030423 TTAAAATAAAGAGGAACCTCAGG + Intergenic
1057565692 9:96164266-96164288 CTAGAACCAAGAGGAAGCTGTGG - Intergenic
1057754168 9:97818091-97818113 ACAAAATCAAGATGATGCTGGGG + Intergenic
1058835494 9:108855799-108855821 CTCAGCTCAAGATGAAGCCCAGG - Exonic
1059963878 9:119594315-119594337 CCATCATCAAGATGAAGCTCAGG + Intergenic
1060225222 9:121786307-121786329 CAAAAAGCCAGATGGAGCTCCGG + Intergenic
1185808906 X:3086918-3086940 CTAAAATCAAGATGTTGGTGGGG + Intronic
1186263627 X:7808063-7808085 CTCAGATCAAGATGAAGCTATGG + Intergenic
1187104490 X:16226905-16226927 ATAAAATCAACATAAAGCCCAGG + Intergenic
1187665381 X:21602983-21603005 CTAAAATCAAGATGAAGCTCAGG - Intronic
1189312564 X:40030167-40030189 CTAAGATCAAGGTGATGCTAGGG - Intergenic
1189631200 X:42955235-42955257 CTAAAATCAAGATGTAGGTAAGG - Intergenic
1192412914 X:70950692-70950714 CTGAAATCAAGATGTAGGCCAGG + Intergenic
1192989174 X:76430453-76430475 CCATAATAAAGATGAAGCTTAGG - Exonic
1193407997 X:81126309-81126331 TAAAACTCAAGATGAAACTCTGG + Intronic
1196040210 X:111194598-111194620 CTAAAATAAACAAGAGGCTCAGG - Intronic
1196407333 X:115378152-115378174 CGAAAATATAGATGAAGGTCTGG - Intergenic
1197454088 X:126655813-126655835 ATAAAATTAAGATCAAGCCCGGG - Intergenic
1197552856 X:127916259-127916281 TTAAAATCAAAATGAGGCCCAGG - Intergenic
1197657828 X:129136693-129136715 CTAAAATCAAGATGCAGGTAGGG - Intergenic
1198133931 X:133727970-133727992 CTACAATCTAGATGAAGCCTTGG + Intronic
1198251935 X:134887614-134887636 TTTAAATCAATGTGAAGCTCAGG + Exonic
1199407142 X:147475450-147475472 CTAAAAAAAAAATGAAACTCTGG - Intergenic
1199903698 X:152203602-152203624 CTAAAATCAGGATGTAGGTGGGG + Intronic