ID: 1187669212

View in Genome Browser
Species Human (GRCh38)
Location X:21651754-21651776
Sequence TGGGGGCCTGTAATGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187669212_1187669214 -9 Left 1187669212 X:21651754-21651776 CCATTCTCCATTACAGGCCCCCA 0: 1
1: 0
2: 3
3: 21
4: 286
Right 1187669214 X:21651768-21651790 AGGCCCCCAGTGCTACAGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 147
1187669212_1187669215 -8 Left 1187669212 X:21651754-21651776 CCATTCTCCATTACAGGCCCCCA 0: 1
1: 0
2: 3
3: 21
4: 286
Right 1187669215 X:21651769-21651791 GGCCCCCAGTGCTACAGAAAGGG 0: 1
1: 0
2: 1
3: 13
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187669212 Original CRISPR TGGGGGCCTGTAATGGAGAA TGG (reversed) Intronic
901770969 1:11530199-11530221 TGAGGGACTGGAATGGAGAGAGG + Intronic
904632410 1:31852343-31852365 TGGGGGCCTGTCATGGGGTGGGG - Intergenic
904730924 1:32590511-32590533 TGTGGGCCAGTAATGGCTAAGGG - Intronic
905262905 1:36731772-36731794 TTGGGGCATGTAGTGGGGAAGGG + Intergenic
905539419 1:38748047-38748069 TGGGAGCCTGTGATGGTCAAAGG - Intergenic
905967148 1:42108198-42108220 TTGGGGGCTGTAATAAAGAAAGG - Intergenic
906321228 1:44818151-44818173 TGGAGGACTGGAATTGAGAAGGG + Intergenic
906702203 1:47867934-47867956 TGGAGGCCTGAAATGGAGTTTGG + Intronic
906890884 1:49712446-49712468 TGGGGGCAGGGAATGAAGAATGG + Intronic
909277412 1:73705356-73705378 TTGGGGGATGGAATGGAGAAGGG + Intergenic
910176663 1:84438019-84438041 TGAGGGCCTGTAAAGGAGAAGGG + Intergenic
910242806 1:85105913-85105935 TGACTGCATGTAATGGAGAACGG + Intronic
912344206 1:108949203-108949225 GTGAGGCCTGGAATGGAGAAGGG - Intronic
915317342 1:155036529-155036551 TGGGGTCCTGCAATGGAGAAGGG + Intronic
915385824 1:155490855-155490877 TGGGAGGCTGAAGTGGAGAATGG + Intronic
915911698 1:159919494-159919516 TTGGAGGCTGGAATGGAGAAGGG - Intronic
916059922 1:161091432-161091454 TGGGGACCTGAAAAAGAGAAGGG - Intergenic
916064708 1:161126824-161126846 TGGGGGTGTGGAATAGAGAAGGG - Intronic
917716016 1:177738740-177738762 TGGGGGAATGAAATGAAGAATGG - Intergenic
918325029 1:183401907-183401929 TGGGGGCCTGTCATGGGGTTGGG + Intronic
919906346 1:202081116-202081138 TGAGGGTCTTTAAGGGAGAAGGG - Intergenic
920100283 1:203513108-203513130 TGGGGAACAGAAATGGAGAAAGG + Intergenic
920390558 1:205597856-205597878 TGGGGACCTGTAAGGGAGAGGGG + Intronic
921895336 1:220394124-220394146 TGGGGTCCTGAAATAGAAAAAGG + Intergenic
921925716 1:220708541-220708563 TGGGGGCCTGTCAGGGAGTGGGG + Intergenic
922916619 1:229263279-229263301 TGGGGGGATGAAATGGAGAGGGG + Intergenic
924375969 1:243409526-243409548 TTTGTGCCTTTAATGGAGAATGG - Intronic
1063117959 10:3085115-3085137 TGGGGGACTGTGCTGGAGAGTGG - Intronic
1063118016 10:3085285-3085307 TGGGGGACTGTGCTGGAGAGTGG - Intronic
1063118022 10:3085310-3085332 TGGGGGACTGTGCTGGAGAGTGG - Intronic
1063118028 10:3085335-3085357 TGGGGGACTGTGCTGGAGAGTGG - Intronic
1063118034 10:3085360-3085382 TGGGGGACTGTGCTGGAGAGTGG - Intronic
1063118040 10:3085385-3085407 TGGGGGACTGTGCTGGAGAGTGG - Intronic
1063118086 10:3085506-3085528 TGGGGGACTGTGCTGGAGAGTGG - Intronic
1063118111 10:3085578-3085600 TGGGGGACTGTGCTGGGGAAGGG - Intronic
1063118121 10:3085602-3085624 TGGGGGACTGTGCTGGGGAAGGG - Intronic
1063118131 10:3085626-3085648 TGGGGGACTGTGCTGGGGAAGGG - Intronic
1063118141 10:3085650-3085672 TGGGGGACTGTGCTGGGGAAGGG - Intronic
1063118151 10:3085674-3085696 TGGGGGACTGTGCTGGGGAAGGG - Intronic
1063118160 10:3085699-3085721 TGGGGGACTGTGCTGGAGAGTGG - Intronic
1063118166 10:3085724-3085746 TGGGGGACTGTGCTGGAGAGTGG - Intronic
1063574803 10:7252090-7252112 TGAGGGCCTGCGATGTAGAAAGG - Intronic
1064106299 10:12503501-12503523 GGGGGGCCTGTGAGAGAGAAGGG + Intronic
1065072211 10:22037199-22037221 TGGGTACATGTAATGGAAAATGG + Intergenic
1065484018 10:26219049-26219071 TGCCGGCGTGTGATGGAGAAAGG + Exonic
1069088943 10:64176133-64176155 TAGTGGCCTGTAATGGAAATAGG - Intergenic
1069724513 10:70568757-70568779 TGGGGGCCTGTGAAGGAGCCTGG + Intergenic
1070906144 10:80075060-80075082 AGGGTGACTGTAATGAAGAAAGG + Intergenic
1070917659 10:80165198-80165220 TGGTGGCCTGGAAAGGAGAGGGG - Intronic
1078819478 11:14863039-14863061 TGGGGGCCTGTTAGGGGGTAGGG - Intronic
1079887714 11:26008594-26008616 TGGGGACATGCAATGGAAAATGG - Intergenic
1080638470 11:34143766-34143788 ACTGGGCCTGTCATGGAGAAGGG + Intronic
1080847772 11:36041380-36041402 TGGGGGTCTCTGATGGAGGAAGG - Intronic
1082300573 11:50499749-50499771 TGGGGGCCAGTCATGGAGTGGGG + Intergenic
1083163049 11:60867464-60867486 TGGGTGCCTGTAAGGGCAAAGGG - Intergenic
1083991483 11:66248672-66248694 TGGGAGTCTGAAATGGAGAAAGG - Intergenic
1084119556 11:67060921-67060943 TAGGGGCCTGTCATTGTGAAGGG - Intronic
1085218165 11:74850261-74850283 TGGGGCTCTGTAAAGGAGAGAGG + Intronic
1085743987 11:79099289-79099311 GGGGGGCCTGCAAAGGAGAGAGG - Intronic
1085901361 11:80703474-80703496 TGGTGGCCTCTTATGGAGTAAGG + Intergenic
1086276777 11:85139111-85139133 TGGGATGATGTAATGGAGAAGGG - Intronic
1087406863 11:97741713-97741735 TGGGGGCCTGTTATGGGGTGGGG - Intergenic
1088164069 11:106910739-106910761 TGGGGGTCTGTAAGGGACCAAGG - Intronic
1088754310 11:112872959-112872981 TGGGCACCAGTAATGGAGACGGG - Intergenic
1089903143 11:122009792-122009814 TGGGAAACTGGAATGGAGAACGG + Intergenic
1090608187 11:128446290-128446312 TGGGGGCCTGTCATGGGGTGGGG + Intergenic
1090992142 11:131827421-131827443 TGGCTGACTGTTATGGAGAAAGG + Intronic
1094041647 12:26125789-26125811 TGGGGGCTGGGAAGGGAGAAGGG + Intronic
1094312354 12:29098147-29098169 TGGGGGCCTGTCATGGAGTTGGG + Intergenic
1094699657 12:32856590-32856612 CTGGGGCCTGTCATGGGGAAGGG + Intronic
1095462547 12:42457871-42457893 TGGGGGACTGGGATGAAGAATGG + Exonic
1095565112 12:43613838-43613860 TGGGGGGCTGGAGGGGAGAAGGG - Intergenic
1097535494 12:60864985-60865007 TGGAGTCCTGGAATGGAAAAAGG - Intergenic
1097575440 12:61387649-61387671 TGGTTGCCTGTAAGGGAGAAAGG + Intergenic
1098096341 12:66960715-66960737 TGGGGGCATCTAGTGAAGAAAGG + Intergenic
1098477907 12:70926681-70926703 TGGATGCCTATAATAGAGAATGG + Intergenic
1100031137 12:90192793-90192815 TGGGGGACTGTACTGTTGAAAGG + Intergenic
1104208193 12:126661010-126661032 TGGGGAACTGTAATGCAGAGGGG - Intergenic
1105847312 13:24304555-24304577 TGGGGGGCTGCAGGGGAGAAGGG - Exonic
1106193742 13:27476119-27476141 TGGGGGCCTGGGATGGAGGGAGG - Intergenic
1107324519 13:39226757-39226779 TCGGGGCCTGTCAGGGAGTAGGG + Intergenic
1107748895 13:43543129-43543151 TGGGGACATGGAATGGGGAAGGG + Intronic
1107872361 13:44759301-44759323 CAGGGCCCTGTAAGGGAGAAGGG + Intergenic
1108429947 13:50343483-50343505 TGGGGGCCTGTCATGGGGTGGGG + Intronic
1109795176 13:67302174-67302196 AGTGGCCCTGAAATGGAGAATGG - Intergenic
1110944172 13:81391972-81391994 TGGGGGCCAGGAATGGAGACAGG - Intergenic
1111076592 13:83244309-83244331 TTGGGGCCTGTCATGGCGTATGG - Intergenic
1112787088 13:102963074-102963096 TGGGGTCCAGGAATGGAGAAAGG - Intergenic
1112988936 13:105486964-105486986 TGTAGACCTGTAATGGAGAGGGG - Intronic
1115121343 14:29941595-29941617 TCTGGGCCTGTGATGGAGTAGGG - Intronic
1115519611 14:34220418-34220440 CAGCTGCCTGTAATGGAGAAAGG + Intronic
1116403740 14:44542493-44542515 TGGGGGCCTGTCATGGGGCGGGG + Intergenic
1117027388 14:51635449-51635471 TGGGCTCCTGTAATTCAGAATGG - Intronic
1118627607 14:67674078-67674100 TGCGGTCCTGTAATGTAGAGTGG - Intronic
1121863465 14:97340632-97340654 TGGGGGTGGGGAATGGAGAAGGG + Intergenic
1121899523 14:97680685-97680707 TTGGGGCCTGTCAGGGAGTAGGG + Intergenic
1122649561 14:103218987-103219009 CGGGGGCAGGTAATGAAGAAGGG - Intergenic
1126498240 15:49316452-49316474 TGGGGGCCTGTAGTGGGGTGGGG + Intronic
1127661049 15:61100514-61100536 TGGAGCCCTGAAGTGGAGAAGGG - Intronic
1127907140 15:63384257-63384279 TGAGGGTCTTTAAAGGAGAAGGG - Intergenic
1129867139 15:78917862-78917884 ACGGGGCCTGTCATGGAGTAGGG + Intergenic
1130873159 15:87988359-87988381 TGTGGTCCAGGAATGGAGAAAGG + Intronic
1133241146 16:4415407-4415429 TGAGGGACTGGGATGGAGAATGG - Intronic
1135103772 16:19629351-19629373 TGTTTACCTGTAATGGAGAATGG + Intronic
1135177435 16:20243012-20243034 TGGGAGCCTGTAGAGGAGAGAGG - Intergenic
1135681863 16:24464258-24464280 TAGGGGTGTGTAATTGAGAAGGG - Intergenic
1137522546 16:49207141-49207163 TGCGAGCCTGAAATGGAGCATGG + Intergenic
1138117676 16:54373363-54373385 TGGGAGCCTGTGAGGCAGAAAGG - Intergenic
1139376792 16:66504096-66504118 TGGGCTCCTGGAATAGAGAAAGG - Intronic
1141166729 16:81665858-81665880 TGGTGGCCTGGAATGCAGGAGGG - Intronic
1144455952 17:15418385-15418407 TGTGTGCCTGCAATGGAGAAGGG - Intergenic
1146934123 17:36800718-36800740 TGGGATCCTGGAATCGAGAAAGG - Intergenic
1147137191 17:38441227-38441249 AGGGGGCCTGAAATGGGGAATGG - Intronic
1148086854 17:44998739-44998761 TGGGGGCCAGTAAGGCAGAGGGG + Intergenic
1148943601 17:51238090-51238112 TGGGGGCCAGGAGTGGAAAAGGG + Intronic
1149553479 17:57556999-57557021 CTGAGGCCTGAAATGGAGAAGGG + Intronic
1149911331 17:60569593-60569615 GAGGGGCCTGTTATGAAGAAAGG - Intronic
1149967948 17:61186650-61186672 TGGGGGCAGGGAAGGGAGAAAGG - Intronic
1150329388 17:64282728-64282750 TGGGGATCTGTAATTGACAAAGG + Intergenic
1150836150 17:68565802-68565824 TGGAGGCCTGGAGTGGAGAAGGG - Intronic
1151510863 17:74559065-74559087 TGGGGGCATGGAATAGGGAATGG - Intergenic
1153177937 18:2399963-2399985 TGGGGGCCTGTCATGGGGTGGGG + Intergenic
1153739210 18:8105664-8105686 TGGGGGCCTGGGAATGAGAATGG - Intronic
1155630146 18:27883485-27883507 TGGGCGGCTGTCATGGAAAAGGG + Intergenic
1155981445 18:32184458-32184480 GGGGGACCTGTCATGGGGAAGGG - Intronic
1156173046 18:34509245-34509267 TGGGGGCCTTTATTTTAGAAAGG - Intronic
1158012504 18:52745326-52745348 TGGTGGCCTGGATTGGAGCAAGG - Intronic
1160564197 18:79776871-79776893 TGGAGGACTGTAATGGATGACGG + Intergenic
1160564279 18:79777382-79777404 TGGAGGACTGTCATGGAGCATGG + Intergenic
1160564328 18:79777676-79777698 TGGAGGACTGTCATGGAGGATGG + Intergenic
1160564343 18:79777750-79777772 TGGAGGACTGTCATGGAGGATGG + Intergenic
1161634700 19:5380447-5380469 TTGGGGTCTGTAAGGGAGAGGGG - Intergenic
1162018649 19:7858716-7858738 GGGGGGCCAGCCATGGAGAATGG + Intronic
1162239203 19:9335265-9335287 GGTGGGGCTGGAATGGAGAAGGG - Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163822176 19:19502315-19502337 TGGAGGCCTGCAGTGGAGAAAGG - Exonic
1164829368 19:31308944-31308966 TGGTGGCCTGTCATGGCGAGTGG - Intronic
1166361772 19:42255479-42255501 TGGGAGCCTGTATGGGAAAACGG + Intergenic
1167893026 19:52557823-52557845 TGGGGGCCTGGAAGGGCTAATGG - Intronic
1167894860 19:52572549-52572571 TGGTGGCCTGGAAGGGATAAAGG - Intronic
1167908916 19:52685336-52685358 TGGGGGCCTGGAAGGGCTAACGG + Intronic
1167925711 19:52819672-52819694 TGGGGGCCTGGAAGGGCTAATGG + Intronic
1167929949 19:52855962-52855984 TGGGGGCCTGGAAGGGCTAATGG + Intronic
1167937728 19:52921472-52921494 TGGGGGCCTGGAAGGGCTAATGG + Intergenic
1168000907 19:53445402-53445424 TGGGGGCCTGGAAGGGCTAATGG - Intronic
925705357 2:6679685-6679707 TGTGAGCCTGTGCTGGAGAATGG + Intergenic
925859109 2:8157824-8157846 TGGGGTCCTGGAAGGGAGAGGGG - Intergenic
926238031 2:11063520-11063542 TTGGGGCCTGTCATGGAGGCAGG + Intergenic
926270719 2:11364024-11364046 TGGGGACGTGTAATGGTTAAGGG + Intergenic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
928246886 2:29638213-29638235 TGGGGACCTGCAATATAGAAAGG + Intronic
932421620 2:71604622-71604644 TAGGGGCCTGGACTGGAGACAGG + Intronic
932967599 2:76495595-76495617 TAGTGGCCTATAATGGAAAATGG - Intergenic
933386631 2:81619169-81619191 TTGGGGCCTGTCGTGGAGTAGGG + Intergenic
933878328 2:86642780-86642802 TGGTTTCCTTTAATGGAGAATGG + Intronic
933880975 2:86669675-86669697 TGGGGGCCTGTCATGGGGTGGGG + Intronic
935430125 2:102966942-102966964 TGGGGATATATAATGGAGAATGG + Intergenic
935713615 2:105920031-105920053 TGGGGACCTGAGATGGAGTAAGG + Intergenic
936875800 2:117187862-117187884 TGGGTGCCAGTTATGAAGAATGG - Intergenic
937492409 2:122383590-122383612 TGGGGGCCTGTCATGGAGTAGGG - Intergenic
938953959 2:136281798-136281820 TGGGGGGCGGAAATGGAGATGGG + Intergenic
939752028 2:146059777-146059799 TGGAAGCCTGAAATAGAGAAAGG + Intergenic
939887796 2:147700103-147700125 TTGGGGGGTGGAATGGAGAAAGG - Intergenic
940337782 2:152546921-152546943 TGGGGGCAAGTAATGCAGGATGG - Intronic
943771963 2:191727695-191727717 TGGGGGCCTCTCGTGGAGAAGGG - Intergenic
943777773 2:191785656-191785678 TGGGGGCCTGTCAGGGAGTGAGG - Intergenic
943887421 2:193239473-193239495 TGGGGTCATGGAATGCAGAAAGG - Intergenic
946855007 2:223943275-223943297 TGTGGGTCTGTAAAGCAGAAAGG - Intronic
947324168 2:228956474-228956496 TGGAGGTCTATATTGGAGAAGGG - Intronic
948183338 2:236000473-236000495 TGGGGGACTGGACTGGAGGAGGG - Intronic
948675825 2:239596022-239596044 ACGGGGCCTGAAGTGGAGAAAGG + Intergenic
1169971011 20:11269587-11269609 TGAGGGCCTATAATGGGGACTGG - Intergenic
1170261583 20:14414418-14414440 TGGGGGCCAGCAATGGAGGCAGG - Intronic
1171401275 20:24874294-24874316 TTGGGGCCTGGCAGGGAGAAAGG + Intergenic
1171456609 20:25276076-25276098 TGGGGGCTTGTCAAGGAGAGAGG + Intronic
1171822111 20:29859833-29859855 TTGAGGCCTGTTATGGAAAAGGG + Intergenic
1173478824 20:43383327-43383349 TGGGTGGCTGTAATAGTGAAAGG - Intergenic
1173818417 20:46005123-46005145 TGGGGGCCTGTTATTAATAATGG + Intergenic
1174517617 20:51104788-51104810 TGGGGGCCTGTGACGGGGGAGGG + Intergenic
1174593918 20:51668219-51668241 TGGGAGCAGGTACTGGAGAAGGG + Intronic
1174668726 20:52285409-52285431 GGAGGGTCTGTAATGGAGAAGGG + Intergenic
1175155897 20:56971372-56971394 TAGGGGCCTGTCATGGAAAGTGG + Intergenic
1176025462 20:62983204-62983226 TCGGGGCCTGTACTGGGGACAGG - Intergenic
1176078015 20:63257645-63257667 TGGAGGACAGTGATGGAGAACGG + Intronic
1177974192 21:27826928-27826950 TGGGGGCCAGTGTTTGAGAATGG - Intergenic
1178712037 21:34925843-34925865 TGGGTGCATGAAATGGAGATGGG + Intronic
1179563515 21:42232124-42232146 TGGGGCCCTGTAAGGCAGAGGGG - Intronic
1180223974 21:46378192-46378214 TGGGTGCCTGAAATCGTGAATGG + Intronic
1181052372 22:20243896-20243918 TCTGGCCCTGTAATGGAGGAGGG - Intronic
1181222004 22:21369219-21369241 TGGGGGCCCGGAAGGGAGACAGG - Intergenic
1183335757 22:37244920-37244942 TGGGGTCCGCTGATGGAGAAGGG + Intergenic
1183593559 22:38796025-38796047 AGGGGGATTGCAATGGAGAAAGG - Intergenic
1184287471 22:43479621-43479643 TGTGGCCCTGTAAAGGGGAAGGG - Intronic
1184825174 22:46945679-46945701 TGTGGGCCTGTACAGGAGCAGGG + Intronic
952106529 3:30076464-30076486 TGAGAGCCTGTAATGGGGGAAGG - Intergenic
953271318 3:41448092-41448114 TTGGGGCCTGTTACAGAGAAGGG - Intronic
953610433 3:44443185-44443207 TGGGGGGCTGGCATGGGGAAGGG + Exonic
954413957 3:50383818-50383840 TGGGGGCAGGGAATGGGGAAGGG + Intronic
957509448 3:81168859-81168881 AGGGGAACTGCAATGGAGAAAGG + Intergenic
958474055 3:94558193-94558215 AGGGGGGCTATAATGGAGTAAGG - Intergenic
959693143 3:109220817-109220839 TGGGGGCCTGTCATGGGGTGGGG + Intergenic
960311116 3:116117547-116117569 TGGGGTCCTGGAATGAAAAAAGG - Intronic
960523811 3:118685745-118685767 TGGGGGTTTATAAGGGAGAATGG + Intergenic
960771169 3:121193810-121193832 TGGGGGCCTGTCATGGGGTAGGG + Intronic
961566478 3:127767200-127767222 TGGGTGCCTGTCATGGAGCCTGG + Intronic
961709187 3:128813905-128813927 TGTGAGCCTGTAATGGGGCATGG - Exonic
961803092 3:129467847-129467869 TGGGGACCAGTAAAGGAGGAAGG + Intronic
962480038 3:135790038-135790060 TGGGGGCCTGTCATGGGGTGGGG - Intergenic
963812943 3:149797428-149797450 TGAGGGTCTTTAAGGGAGAAAGG + Intronic
965883411 3:173414109-173414131 TGGGGGCCTGGAAGGGAGAGGGG + Intronic
968309252 3:197669283-197669305 TGGGATCCCGAAATGGAGAAAGG - Intergenic
968794885 4:2696750-2696772 TGGTGGCCTGAACTGGAGACTGG + Intronic
969168801 4:5341999-5342021 CTGGGGCCTGTCATGGAGTAGGG - Intronic
970490434 4:16568012-16568034 TGGTGGCCTGTTTTGGATAAAGG + Intronic
971497528 4:27282911-27282933 TTGAGGACTGTAATGGAGACAGG - Intergenic
973104399 4:46315844-46315866 TAGGGGGCTGTGATTGAGAAGGG - Intronic
973661557 4:53112541-53112563 TTATGTCCTGTAATGGAGAAAGG - Intronic
973836315 4:54813047-54813069 TGGGGGCCTGTCATGGGGTGGGG + Intergenic
976024405 4:80670142-80670164 TGGGGGTCTGTCATGGGGAGGGG - Intronic
976975341 4:91160050-91160072 TGGGGGCCTGTCATGGGGTGGGG - Intronic
978795231 4:112702101-112702123 TGGGGACGTGCAATGGAGTAGGG + Intergenic
979721942 4:123910738-123910760 TAGGGGTCTGCAATGGTGAATGG + Intergenic
982761962 4:159295087-159295109 AGGGGGCCTGTATTGTATAATGG - Intronic
983501653 4:168506382-168506404 TGGGGGGCGGTAAGAGAGAAAGG - Intronic
983681153 4:170354939-170354961 TGGGGGCCTGTCATGGGGTGGGG - Intergenic
986241344 5:5962265-5962287 CGGGGGCCTGTGCTGGTGAAAGG - Intergenic
987281251 5:16415756-16415778 TGGGGGGGTGAAATAGAGAAGGG + Intergenic
987573429 5:19695651-19695673 TGGGGGGCTGTAATCAGGAATGG + Intronic
988412242 5:30901436-30901458 TTGGTGCCTTTAATGGAAAAAGG + Intergenic
988654186 5:33189924-33189946 TGGGGGCCTGTTGTGGGGGAGGG - Intergenic
989570059 5:42937701-42937723 TGGGGGCCTGTTATGGGGTGGGG + Intergenic
991173122 5:63652108-63652130 TGGGGGCAGATAATGGAGGAAGG + Intergenic
991551352 5:67840178-67840200 TGGGGCCCTGGAACTGAGAAAGG - Intergenic
991640744 5:68749412-68749434 GGGGGGCCTGTGATAGACAAAGG - Intergenic
992212559 5:74495127-74495149 TAGGGCTCTGTAATGGGGAAGGG + Intergenic
992369335 5:76126771-76126793 TGGGAGCCTGTGATGGAAACAGG - Intronic
992977167 5:82132408-82132430 CGGGGGCCTGTAATGGGGTGGGG - Intronic
995753351 5:115476122-115476144 TGGGAACCTGTAAAGGGGAAGGG - Intergenic
998170834 5:139871142-139871164 TGGGGTCCTGTAGGGCAGAAGGG + Intronic
998367167 5:141638982-141639004 TGGGGGACAGTGAAGGAGAAGGG + Exonic
1000182058 5:158821111-158821133 TGGGGGCAGGTAATGTAGATAGG - Intronic
1000563789 5:162823290-162823312 TGGGGGCCTGTCATGGGGTAGGG - Intergenic
1000675804 5:164121181-164121203 TTGGGGCCTGTTGTGGGGAAGGG - Intergenic
1001686794 5:173599441-173599463 AGGGGCCCTGTAAAGCAGAAGGG + Intergenic
1002055650 5:176596741-176596763 TAGGGGCCTGTGATCAAGAAGGG + Exonic
1004318507 6:14613484-14613506 CAGGCGCCTGGAATGGAGAAGGG - Intergenic
1004520778 6:16359091-16359113 TGGGTGCCTGGAACGGAGAGAGG - Intronic
1004910781 6:20280714-20280736 TGGGGTCCTGTGAGTGAGAAGGG + Intergenic
1005154431 6:22787991-22788013 GATGTGCCTGTAATGGAGAAAGG - Intergenic
1005969417 6:30749634-30749656 TGGGGGCCTCTAAAGGAACATGG - Intergenic
1006242044 6:32691136-32691158 TGGGGGCCTGTTGTGGGGAGGGG - Intergenic
1007546835 6:42700829-42700851 TTGGGGCCTTTAATGGACAGAGG - Intronic
1009237010 6:61135477-61135499 TGGGGGCCTGTTATGGGGTTGGG - Intergenic
1009960636 6:70516638-70516660 TGGGAGGCTGAGATGGAGAATGG - Intronic
1014825677 6:126046601-126046623 TGGGGGACTTTATAGGAGAAAGG + Intergenic
1020915128 7:14183998-14184020 TGGGGGCATGTGATGGGGAGAGG - Intronic
1021072189 7:16254575-16254597 TGGGGGCCTGTAGTGGGGTGAGG + Intronic
1021749861 7:23785831-23785853 TGGGGGCCTGTCATGGGGTGGGG + Intronic
1021845999 7:24763045-24763067 TGGATGCCTGAAATGGAGGATGG + Intergenic
1022802047 7:33786119-33786141 TGAGGGACTGTATTGGAGAGGGG + Intergenic
1023819560 7:43973062-43973084 TGGGGGCCTGGGAGGGCGAAAGG - Intergenic
1023834326 7:44059479-44059501 TGGGGGACAGCAGTGGAGAAGGG + Intronic
1023912092 7:44563483-44563505 TGTGGGCCTGGAAGGGAGGAAGG - Intergenic
1026366725 7:69655790-69655812 TGGGGACCTGTTTAGGAGAAGGG + Intronic
1028085348 7:86629723-86629745 TGGGAGCCTGGAACAGAGAAAGG - Intergenic
1028088838 7:86672232-86672254 AGGAAGCCTGTAGTGGAGAAGGG + Intronic
1028984786 7:97001245-97001267 TGGGGGCATCTAAGAGAGAAGGG + Intergenic
1029169900 7:98623025-98623047 TGGGGGATTGTGGTGGAGAAAGG + Intronic
1029423673 7:100484141-100484163 TGGGGCCCTTGGATGGAGAAGGG + Intronic
1030348162 7:108456046-108456068 CGGGGGCCTGCAGGGGAGAAGGG + Intronic
1030720658 7:112866741-112866763 TTGGGACCTATAGTGGAGAATGG - Intronic
1035652643 8:1280512-1280534 TGGGGGTCTATAAAGGAGGAGGG + Intergenic
1035905764 8:3508344-3508366 CGGGGGCCTGTTATGGGGCAGGG + Intronic
1038115659 8:24552353-24552375 TGGGGGCATGTAAGGGATACAGG + Intergenic
1038672045 8:29590506-29590528 TGGGGGGAGGCAATGGAGAATGG + Intergenic
1039285348 8:36034052-36034074 TGGGGGCCTGGCATGGGGATGGG + Intergenic
1039515385 8:38128354-38128376 TGAGGGCCTCTCATGGAGTACGG + Exonic
1039695379 8:39904906-39904928 TGGAGCTCTGTAATGGAGACAGG - Intronic
1041000593 8:53446657-53446679 CTGGGGCCTGTCATGGAGTAGGG + Intergenic
1043393330 8:79812284-79812306 TTGGGTCCTGGAAGGGAGAAGGG + Intergenic
1043915522 8:85918417-85918439 CTGGGGCCTGTAATGGGGTAGGG + Intergenic
1045070617 8:98500516-98500538 TGGGGGCCTGTCATGGGGTAGGG - Intronic
1047229178 8:122981380-122981402 TGGGGGCTTGTTATGGATGAAGG - Intergenic
1047307827 8:123667468-123667490 AGGCAGCCTGTGATGGAGAAGGG + Intergenic
1048758065 8:137760690-137760712 TGAAGGCTTTTAATGGAGAAGGG + Intergenic
1048877414 8:138847728-138847750 TGGGGGACTGTCTAGGAGAATGG + Intronic
1049499723 8:142955387-142955409 TGGGGGACTTTAATGAAGGAAGG + Intergenic
1049926216 9:410247-410269 GGGGGGCCTGTAACTGAGAGAGG - Intronic
1051329502 9:16008947-16008969 TGGGGGCCTGGACTGGCCAAGGG - Intronic
1051615758 9:19004704-19004726 TGGGGGCCTGTTGTGGAGTAGGG + Intronic
1053077005 9:35141734-35141756 AGGGGGTCTATATTGGAGAAGGG - Intergenic
1053364000 9:37510003-37510025 TGGGATCCTGGAATGGAAAAAGG + Intergenic
1055372645 9:75616942-75616964 TGAGGGTCTGGAATGGGGAAAGG + Intergenic
1057387314 9:94615390-94615412 GGGGGGACTGAGATGGAGAATGG + Intronic
1060548485 9:124474486-124474508 TTGGGGTCTGTCTTGGAGAATGG + Intronic
1062197161 9:135280680-135280702 TGAGGGGCGGTAATGGAGACTGG + Intergenic
1186226522 X:7404865-7404887 TTGGGTGCTGGAATGGAGAAGGG - Intergenic
1187396451 X:18923527-18923549 TTGGGGCCTGTAAACCAGAAGGG + Intronic
1187669212 X:21651754-21651776 TGGGGGCCTGTAATGGAGAATGG - Intronic
1190975429 X:55395755-55395777 TAGGTGCCTGTAAGGAAGAAAGG - Intergenic
1191120830 X:56902704-56902726 TTGGGGCCTGTTGTGGAGAAAGG + Intergenic
1191734014 X:64369601-64369623 TGGGGGCCTATCATGGAGGAGGG + Intronic
1192154438 X:68733281-68733303 TAGGGCTCTGTAATGGAGAATGG - Intergenic
1196438435 X:115695295-115695317 TGGAGACCTGTAATGCAGGAGGG + Intergenic
1197188742 X:123620915-123620937 TGGAGGAATGTGATGGAGAAGGG + Exonic
1201237401 Y:11924311-11924333 TGGTACCCTGCAATGGAGAAAGG + Intergenic
1202095856 Y:21247653-21247675 AGGTGGTCTGTGATGGAGAAAGG + Intergenic
1202163346 Y:21958585-21958607 TGGGGGCCTGGTAGGGAGATGGG + Intergenic
1202228010 Y:22627783-22627805 TGGGGGCCTGGTAGGGAGATGGG - Intergenic
1202315147 Y:23568393-23568415 TGGGGGCCTGGTAGGGAGATGGG + Intergenic
1202555654 Y:26102200-26102222 TGGGGGCCTGGTAGGGAGATGGG - Intergenic