ID: 1187670492

View in Genome Browser
Species Human (GRCh38)
Location X:21661554-21661576
Sequence GTTGATAGACAGATCTAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187670486_1187670492 13 Left 1187670486 X:21661518-21661540 CCTAGAAGCACGCTTTGTGACCC No data
Right 1187670492 X:21661554-21661576 GTTGATAGACAGATCTAACAGGG No data
1187670489_1187670492 -8 Left 1187670489 X:21661539-21661561 CCAACCTGAAGGAATGTTGATAG No data
Right 1187670492 X:21661554-21661576 GTTGATAGACAGATCTAACAGGG No data
1187670488_1187670492 -7 Left 1187670488 X:21661538-21661560 CCCAACCTGAAGGAATGTTGATA No data
Right 1187670492 X:21661554-21661576 GTTGATAGACAGATCTAACAGGG No data
1187670485_1187670492 14 Left 1187670485 X:21661517-21661539 CCCTAGAAGCACGCTTTGTGACC No data
Right 1187670492 X:21661554-21661576 GTTGATAGACAGATCTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187670492 Original CRISPR GTTGATAGACAGATCTAACA GGG Intergenic
No off target data available for this crispr