ID: 1187672866

View in Genome Browser
Species Human (GRCh38)
Location X:21685960-21685982
Sequence GGTTAGGGACAGCCACCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187672866_1187672871 7 Left 1187672866 X:21685960-21685982 CCCTGAGGTGGCTGTCCCTAACC No data
Right 1187672871 X:21685990-21686012 ACTCCTTGACTTTAGAATGTAGG No data
1187672866_1187672874 15 Left 1187672866 X:21685960-21685982 CCCTGAGGTGGCTGTCCCTAACC No data
Right 1187672874 X:21685998-21686020 ACTTTAGAATGTAGGGTGCTTGG No data
1187672866_1187672872 8 Left 1187672866 X:21685960-21685982 CCCTGAGGTGGCTGTCCCTAACC No data
Right 1187672872 X:21685991-21686013 CTCCTTGACTTTAGAATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187672866 Original CRISPR GGTTAGGGACAGCCACCTCA GGG (reversed) Intergenic
No off target data available for this crispr