ID: 1187673630

View in Genome Browser
Species Human (GRCh38)
Location X:21693342-21693364
Sequence GTAGAGTTGGTTTCTGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187673630_1187673633 5 Left 1187673630 X:21693342-21693364 CCAACAACAGAAACCAACTCTAC No data
Right 1187673633 X:21693370-21693392 TTAGAGAGAAAATGAATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187673630 Original CRISPR GTAGAGTTGGTTTCTGTTGT TGG (reversed) Intergenic