ID: 1187676689

View in Genome Browser
Species Human (GRCh38)
Location X:21723345-21723367
Sequence CACCCACAGGATGCTGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187676683_1187676689 18 Left 1187676683 X:21723304-21723326 CCACAGCTCTAGGCCAATCTGAA 0: 1
1: 0
2: 0
3: 17
4: 177
Right 1187676689 X:21723345-21723367 CACCCACAGGATGCTGTCCTTGG 0: 1
1: 0
2: 2
3: 29
4: 231
1187676686_1187676689 5 Left 1187676686 X:21723317-21723339 CCAATCTGAAAAGGGTTTCCTTT 0: 1
1: 0
2: 3
3: 31
4: 292
Right 1187676689 X:21723345-21723367 CACCCACAGGATGCTGTCCTTGG 0: 1
1: 0
2: 2
3: 29
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187676689 Original CRISPR CACCCACAGGATGCTGTCCT TGG Intronic
900347384 1:2216210-2216232 CACCCACTGAACCCTGTCCTGGG - Intergenic
900531831 1:3157712-3157734 TACCCACAGGAGGCTGTGTTTGG + Intronic
901013396 1:6213509-6213531 CACCCACAGGACCCTGTTCAGGG + Intronic
901606381 1:10462455-10462477 CACCAACAGGAAGAAGTCCTTGG + Intronic
902437020 1:16404861-16404883 CACCTAAAGGATCCTGTGCTTGG - Intronic
902546746 1:17195058-17195080 CCCCCACAGGCTCCTGTGCTGGG - Intergenic
902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG + Intronic
903035747 1:20491572-20491594 CAACCACAGGAGTGTGTCCTGGG + Intergenic
903461155 1:23521836-23521858 CACCCACTGGATGTTGTTCTTGG + Exonic
904365188 1:30006297-30006319 CACTCAGAGGCTGCTGTCCTGGG - Intergenic
904708653 1:32411678-32411700 CACCCCCAGGGTGGTTTCCTGGG + Intergenic
904949899 1:34228465-34228487 CTCTCACAGGATGCAGTCCAAGG + Intergenic
905536280 1:38724554-38724576 CTCCAACAGGAAGCTGCCCTTGG - Intergenic
905581233 1:39083865-39083887 AACCCACAGCATTCTGTCATGGG + Intronic
905602880 1:39269196-39269218 CTGCTGCAGGATGCTGTCCTAGG - Intronic
906069777 1:43008071-43008093 CACCCACAGAAGACTTTCCTGGG - Intergenic
907312169 1:53544927-53544949 CACCCACAACATGAGGTCCTTGG - Intronic
908655274 1:66382103-66382125 CACCCACACGAGCCTGTGCTTGG + Intergenic
908655480 1:66383455-66383477 CACCCACATGAGCCTGTGCTTGG + Intergenic
910937174 1:92493844-92493866 CTCCCACAGGAGGCTTTCCAAGG + Intergenic
911049236 1:93655491-93655513 CACCCACAGAATTCTTTCCAAGG + Intronic
911378835 1:97086846-97086868 TGCCCACAGCATGCTGTTCTGGG - Intronic
912581597 1:110725874-110725896 CAGCCACAAGATGTTGTTCTAGG - Intergenic
912806069 1:112758115-112758137 CTCCCTCAGGCTGCTCTCCTGGG + Intergenic
915489091 1:156241653-156241675 CACCCACAGCAGGCTGCCTTTGG + Intronic
916717629 1:167458422-167458444 CACCAGTAGGATGCTGTGCTGGG - Intronic
916731046 1:167567095-167567117 CGACCACAGCATCCTGTCCTGGG + Intergenic
917187830 1:172381180-172381202 CACCTACAGGATATTATCCTCGG + Intronic
917978975 1:180257790-180257812 CACGCACAGGAGGCTGACATGGG + Intronic
919755047 1:201061455-201061477 CACCCCCAGGCTGCTGTACAAGG - Exonic
919977710 1:202623479-202623501 AACCCACAGGCAGCTGTCCTGGG + Intronic
920117083 1:203628760-203628782 CACTCCCAGGCTGCTTTCCTGGG - Intronic
922863281 1:228837716-228837738 CATCCACAGGAAGGTGTGCTGGG - Intergenic
1065571347 10:27073305-27073327 CACGCACATCATGCTGTCGTGGG - Intronic
1067283031 10:44887273-44887295 CACTCACAGGATGCTTACTTAGG - Intergenic
1067299150 10:44993514-44993536 CACCCACAGGAAGCCGACCCAGG + Exonic
1067545944 10:47192855-47192877 CACACACACTAAGCTGTCCTGGG + Intergenic
1068455609 10:57250264-57250286 CACCCAGTGGATGCCGCCCTGGG - Intergenic
1069018515 10:63460016-63460038 TACCCACACAATGCTATCCTTGG + Intronic
1069198753 10:65587267-65587289 CACACACCGGGTGCTGTCATGGG - Intergenic
1070305285 10:75235670-75235692 CTGCCACAGGCGGCTGTCCTCGG + Exonic
1076074537 10:127522766-127522788 CACCCACACCTGGCTGTCCTTGG + Intergenic
1076521906 10:131086546-131086568 CTCCCACAGGAGAATGTCCTGGG + Intergenic
1076685778 10:132197881-132197903 CACCGTCAGGAGGTTGTCCTGGG + Intronic
1078348887 11:10576108-10576130 CATCCACTGGATGCTTTCCCAGG + Exonic
1078758703 11:14234631-14234653 CACCCACCGGAGGCAGCCCTTGG + Intronic
1080271573 11:30455943-30455965 CACAGACAGGACGCTGCCCTGGG + Intronic
1081574052 11:44308668-44308690 CAGCCACAGGAGGCAGGCCTGGG - Intronic
1082160563 11:48884179-48884201 CATCCACAGGAGGCTCTCCGAGG - Intergenic
1082161803 11:48896227-48896249 CATCCACAGGAGGCTCTCCGAGG + Intergenic
1084273827 11:68042082-68042104 CGCCCACAGGACGAAGTCCTGGG - Intronic
1084604548 11:70164926-70164948 CGCCTACAGGCTGCTGTGCTTGG - Intronic
1084751081 11:71204850-71204872 CATCCACAGGATGCTGACCACGG + Intronic
1086431634 11:86742191-86742213 CACCCAGGGGATGCTTCCCTTGG - Intergenic
1088454592 11:110020475-110020497 TTCCCACTGGCTGCTGTCCTTGG + Intergenic
1089535300 11:119157252-119157274 CAGCTACAGTGTGCTGTCCTCGG + Intronic
1091749642 12:3014369-3014391 CATCCACTGAAGGCTGTCCTTGG - Intronic
1091873516 12:3914866-3914888 GATCCCCAGTATGCTGTCCTTGG - Intergenic
1092868373 12:12784224-12784246 AACACACAGGATGATGTCCAGGG + Intronic
1094779200 12:33771226-33771248 CACCAACCAGATGCAGTCCTTGG - Intergenic
1101322874 12:103688696-103688718 AAGCAACAGGAAGCTGTCCTGGG - Intronic
1101962292 12:109259155-109259177 CACCCAGAGGGTGCTGTCCTGGG - Intronic
1102028204 12:109725446-109725468 AACCCACAGGGTGCAGACCTAGG - Intronic
1102032845 12:109752998-109753020 GACCCACAGGCTGCTGGCCCAGG - Intronic
1102241112 12:111325476-111325498 CACTCACTGGATGATGGCCTTGG - Intronic
1102255064 12:111410385-111410407 CACCCACAGGCTGCCCTCCTAGG + Intronic
1102556499 12:113730108-113730130 CAGCCACAGCTTGCTTTCCTTGG + Intergenic
1103415157 12:120738401-120738423 CTCCCCCAGGATGCTGTCCTTGG - Exonic
1104758942 12:131285733-131285755 ACCCCACAGAGTGCTGTCCTAGG + Intergenic
1104788267 12:131465712-131465734 CACACACACGATTCTCTCCTTGG + Intergenic
1104821668 12:131680763-131680785 ACCCCACAGAGTGCTGTCCTAGG - Intergenic
1104904527 12:132206118-132206140 CCACCACAGAATCCTGTCCTCGG + Intronic
1109217188 13:59603297-59603319 CACAGACTGAATGCTGTCCTGGG + Intergenic
1109798950 13:67349494-67349516 CACACACTGGAGGCTGTCATGGG - Intergenic
1110772592 13:79366753-79366775 CAACAACAGGAGGCTGTGCTGGG + Exonic
1112037658 13:95512576-95512598 GCCACACAGGATGCTGTCCTGGG + Intronic
1112584412 13:100705571-100705593 CTCTCTCAGAATGCTGTCCTGGG + Intergenic
1113882530 13:113635614-113635636 CACCTACAGGGTGATGGCCTTGG - Intronic
1117579375 14:57136878-57136900 CAGCAGCAGGATGCTGTGCTGGG - Intergenic
1117584135 14:57182793-57182815 CAACCACAGCATGCTGTGCAAGG - Intergenic
1121562761 14:94887068-94887090 CATTCACAGGAGGCTGGCCTGGG + Intergenic
1122277759 14:100603956-100603978 CTCCCACAGGCTGCTGCCCCTGG + Intergenic
1122366035 14:101195322-101195344 TGCTAACAGGATGCTGTCCTGGG + Intergenic
1123667876 15:22623199-22623221 AACCCACTGGATGCTTTCCTAGG + Intergenic
1124321711 15:28717751-28717773 AACCCACTGGATGCTTTCCTAGG + Intronic
1124493358 15:30171843-30171865 AACCCACAGGCAGCTGTCCTGGG + Intergenic
1124522808 15:30419589-30419611 AACCCACTGGATGCTTTCCTAGG + Intergenic
1124535857 15:30546628-30546650 AACCCACTGGATGCTTTCCTAGG - Intergenic
1124750176 15:32366482-32366504 AACCCACAGGCAGCTGTCCTGGG - Intergenic
1124762794 15:32460972-32460994 AACCCACTGGATGCTTTCCTAGG + Intergenic
1124775832 15:32588086-32588108 AACCCACTGGATGCTTTCCTAGG - Intergenic
1127600904 15:60535724-60535746 CACCCACAGAATGAAGTACTGGG - Intronic
1129141010 15:73597949-73597971 CTCACACAGGATTCTATCCTGGG + Intronic
1129825127 15:78629873-78629895 CAGCCACAGGACGCTGCCGTTGG + Exonic
1130264024 15:82382241-82382263 AACCCACTGGATGGTTTCCTAGG - Intergenic
1130271048 15:82447487-82447509 AACCCACTGGATGGTTTCCTAGG - Intergenic
1130276995 15:82485350-82485372 AACCCACTGGATGGTTTCCTAGG + Intergenic
1130463387 15:84174814-84174836 AACCCACTGGATGGTTTCCTAGG - Intronic
1130469359 15:84212701-84212723 AACCCACTGGATGGTTTCCTAGG + Intergenic
1130476849 15:84327265-84327287 AACCCACTGGATGGTTTCCTAGG + Intergenic
1130489285 15:84419974-84419996 AACCCACTGGATGGTTTCCTAGG + Intergenic
1130494916 15:84460865-84460887 AACCCACTGGATGGTTTCCTAGG - Intergenic
1130500878 15:84498736-84498758 AACCCACTGGATGGTTTCCTAGG + Intergenic
1130508385 15:84568826-84568848 AACCCACTGGATGGTTTCCTAGG + Intergenic
1130552007 15:84895248-84895270 CACCCACTGGCTCCTGCCCTGGG - Intronic
1130591653 15:85217330-85217352 AACCCACTGGATGGTTTCCTAGG + Intergenic
1131297411 15:91162923-91162945 CACACACAGGAGCCTGTCGTGGG - Intronic
1132186993 15:99808957-99808979 AACCCACTGGATGGTTTCCTAGG - Intergenic
1132428694 15:101743768-101743790 AACCCACTGGATGGTTTCCTAGG + Intronic
1132658163 16:1049869-1049891 CTCCCACTGGGTGCTGTGCTGGG + Intergenic
1136397515 16:30001245-30001267 CAGCAGCAGGATGCTGTCCTGGG - Intronic
1136790307 16:32964038-32964060 CATCCACAGGATGGGGACCTGGG - Intergenic
1136879507 16:33889890-33889912 CATCCACAGGATGGGGGCCTGGG + Intergenic
1138086528 16:54138906-54138928 CACCCAAAGCCTGCTGTCCATGG - Intergenic
1138715891 16:59021632-59021654 CACCCAGAGGCTGCTGTACATGG - Intergenic
1139473880 16:67192849-67192871 CTTCCACTGGATGCTGTTCTTGG - Exonic
1203092510 16_KI270728v1_random:1225489-1225511 CATCCACAGGATGGGGGCCTGGG - Intergenic
1142967663 17:3591340-3591362 GGCCCACAGGCTGCTGTCCCAGG - Exonic
1143495152 17:7308244-7308266 CCCCCACGGGAGGCTGCCCTCGG + Intronic
1143741727 17:8959265-8959287 CTCCCACAGGGAGCTGTGCTGGG + Intronic
1143992126 17:10974807-10974829 CAACCACAGGAATCTGTCCTAGG - Intergenic
1144249878 17:13405649-13405671 CATTCACAGGATGCTGCCTTGGG - Intergenic
1145863281 17:28225360-28225382 CACCCACAGCCATCTGTCCTGGG + Intergenic
1148356433 17:46978816-46978838 CACCCACAGGCTGCGCTCGTCGG + Exonic
1148782019 17:50127870-50127892 CTCCTTCAGGAAGCTGTCCTAGG + Intronic
1150639172 17:66938053-66938075 CCCACAAAGGATGCTTTCCTTGG + Intergenic
1150759290 17:67945713-67945735 CACGAACAGGAGACTGTCCTTGG - Exonic
1152265912 17:79294663-79294685 CACCCGCAGGTCGCTGTCCGTGG - Intronic
1152557167 17:81059137-81059159 CCCCCACAGGCTGCTGCCTTGGG + Intronic
1152992404 18:375335-375357 TACCCACAGGAGAGTGTCCTAGG - Intronic
1153056852 18:954362-954384 AACACACAGGATGCAGACCTTGG - Intergenic
1156942567 18:42787139-42787161 CACACACAGGAGCCTGTCGTGGG - Intronic
1157114598 18:44851257-44851279 CTCCTACAGGAAGCTTTCCTGGG - Intronic
1157121785 18:44918007-44918029 CTCCCACAGCATGCCGCCCTCGG + Intronic
1157328725 18:46687824-46687846 CATTCACTGAATGCTGTCCTGGG + Intronic
1160015121 18:75134244-75134266 CAGCCAGAGGATGCTGCCCAGGG + Intergenic
1161080969 19:2309950-2309972 CCCCCACAGGATGCTGTGGGGGG + Intronic
1161247063 19:3258990-3259012 CTCCCTCAGGGTGCTGTCCCTGG - Intronic
1161428992 19:4219931-4219953 CACACACAGGCTGCTGTTCCAGG + Intronic
1161641412 19:5425772-5425794 CTCACACTGGATGCTGTGCTGGG - Intergenic
1162894493 19:13757162-13757184 CACCCAAAGGCGGCTGTCCCTGG + Intronic
1163367947 19:16886631-16886653 CACGCACAGGAAGATGTCCTTGG - Intergenic
1165059489 19:33198139-33198161 CACCAGCAGGAGGGTGTCCTGGG - Intronic
1165234457 19:34409320-34409342 CGCCTGCAGGATGCTGTCCTGGG + Exonic
1165603615 19:37079727-37079749 CAGCCACTGGATGCTGTGCGCGG + Intronic
1168131581 19:54323380-54323402 CACCCACAGCATTCTAGCCTGGG + Intergenic
925275355 2:2644783-2644805 CTCTCACAGGATGCAGTCCCAGG - Intergenic
925365843 2:3311762-3311784 CACTCGCAGGATGCTGTGGTGGG + Intronic
928001583 2:27527497-27527519 CACCTACAGGGTGCTACCCTCGG + Intergenic
928444375 2:31319980-31320002 CAGCCACAGATTCCTGTCCTAGG - Intergenic
928448424 2:31354082-31354104 CACCCACACCATGATGTCCATGG + Intronic
929754458 2:44752534-44752556 CACCCACAGAATCCTTTCCTTGG + Intronic
931134176 2:59377901-59377923 CACCTACTGCATCCTGTCCTGGG + Intergenic
931937303 2:67213714-67213736 CACCCTCAGCAGGCTGTCCTGGG + Intergenic
935333117 2:101991818-101991840 CACCCCCAGGCTGCAGTGCTGGG - Intergenic
939173435 2:138722499-138722521 GAGCAACAGGAAGCTGTCCTGGG + Intronic
942601671 2:177646926-177646948 CCCCTCCAGAATGCTGTCCTTGG + Intronic
943426782 2:187747868-187747890 CACACACTGGAGCCTGTCCTGGG + Intergenic
945728230 2:213500156-213500178 AACCCACAGAATGCTTTCATGGG + Intronic
947876504 2:233471177-233471199 CAGCGACAGGAGGCTGTGCTGGG - Exonic
948242743 2:236451664-236451686 CACCCACAGCGTGGCGTCCTTGG - Intronic
948290219 2:236818907-236818929 GCCCCACAGGCTGCCGTCCTTGG - Intergenic
949017198 2:241720184-241720206 CACACCCAGGATGATGCCCTTGG - Intronic
1170587569 20:17746487-17746509 AGCCCACAGAATGCTGTCCCAGG - Intergenic
1171256998 20:23696946-23696968 CACACACTGGGTCCTGTCCTGGG + Intergenic
1173893123 20:46528818-46528840 CAGCCACTGGATCCTTTCCTAGG + Intergenic
1175415319 20:58797079-58797101 CACCCACAGTAACCTGTCCAGGG + Intergenic
1180087193 21:45513052-45513074 CAGCCCCAGGCTGCTGTGCTTGG - Exonic
1180720326 22:17903115-17903137 CACCCACAGGGTGCAGCCCACGG + Intronic
1181485681 22:23230382-23230404 CACCCTCAGAATGCTGTCTAAGG - Intronic
1181489923 22:23255289-23255311 CACACACAGGCTGCTGCCTTAGG + Intronic
1181975118 22:26723340-26723362 AACCCACAGGTCCCTGTCCTAGG - Intergenic
1182481878 22:30614482-30614504 CACCCACAGAATGGTGGCCCTGG - Exonic
1183526452 22:38326007-38326029 CAGCCTGAAGATGCTGTCCTGGG + Intronic
1183598179 22:38824744-38824766 CACCCCCTGGCTGCCGTCCTTGG - Intronic
1183718761 22:39550014-39550036 CACACACAGGAGGCTGTGATGGG - Intergenic
1184236011 22:43183402-43183424 GTCCCACAGGATGCTGTGCATGG + Intronic
1184616164 22:45640049-45640071 CACCTCCAGGAAGCTGTCCTGGG - Intergenic
1184839731 22:47045759-47045781 CACTCACAGGTTGCTGTGGTTGG - Intronic
1184879089 22:47293808-47293830 CATCCTCAGGGTGCTGTACTGGG - Intergenic
1185241246 22:49748846-49748868 CACCCAGGTGCTGCTGTCCTTGG - Intergenic
1185272976 22:49937118-49937140 CACCCCCAGCCTGCTGTCCCAGG + Intergenic
1185404720 22:50641370-50641392 CACCCTGAGGGAGCTGTCCTGGG - Intergenic
950579679 3:13854040-13854062 CTGCCCCAGGATGGTGTCCTGGG - Intronic
950622136 3:14214526-14214548 CAGCCACAGGATACTGTACCCGG + Intergenic
950784967 3:15427111-15427133 CACTCACAAGAGGCTGTCATAGG + Intronic
951053190 3:18118163-18118185 CACACACCGGAGCCTGTCCTGGG + Intronic
952866189 3:37856666-37856688 CACCCACAGGTCTCTCTCCTGGG - Intergenic
954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG + Intronic
954463172 3:50639136-50639158 CGCCCACTGGATGCTTGCCTTGG + Intronic
954580858 3:51702317-51702339 CATTCACAGGCTTCTGTCCTGGG + Intronic
956072673 3:65471130-65471152 CACCCACATGATACTGTTCTGGG - Intronic
957776157 3:84759279-84759301 CACCCACCAGATGCTGTTCAAGG - Intergenic
959953349 3:112206824-112206846 CACACACCGGATCCTGTCGTGGG + Intronic
960664440 3:120095419-120095441 CACCCACAGGAGGCTCTCGGCGG + Intergenic
961385092 3:126518682-126518704 GACCCACAGGATGCTCTCAGAGG - Intergenic
963177261 3:142312917-142312939 CAACCTCAGGATCCTTTCCTAGG + Intronic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
968451643 4:678796-678818 CACCCCCAGGAGCCTGTGCTGGG + Intronic
968532215 4:1098463-1098485 CACCTCCAGGATGCTCTGCTTGG - Intronic
968592564 4:1466253-1466275 CACCTGCAGGGTCCTGTCCTGGG - Intergenic
968651162 4:1760824-1760846 CACTCCCAGGATGCCTTCCTTGG - Intergenic
969639510 4:8388602-8388624 CACCTGCAGGAGGCTGTCCGTGG + Intronic
969709035 4:8832106-8832128 CTCCCACTGGATGCAGGCCTGGG - Intergenic
970838952 4:20444030-20444052 CACTCAAAGGATGTTATCCTTGG + Intronic
979601063 4:122586973-122586995 TACCCACAGGTTGCAGTGCTTGG - Intergenic
979840220 4:125429992-125430014 CACACACCGGGTTCTGTCCTGGG + Intronic
980510750 4:133784462-133784484 CACCCACTAGAGGTTGTCCTAGG - Intergenic
982479961 4:155897226-155897248 CACACACAGGAGCCTGTCATGGG + Intronic
984751516 4:183281009-183281031 CACCTTCAGGAAGCTGTGCTAGG + Intronic
985420516 4:189780913-189780935 AAGCCACAGGATGTTGTCCCTGG + Intergenic
986234382 5:5893642-5893664 GAGCCACAGGCTGCTGCCCTGGG + Intergenic
986395738 5:7327906-7327928 CACCAACAGGATGCTCTCACAGG - Intergenic
986516403 5:8569168-8569190 CATCCACAGGAAACTGTTCTGGG + Intergenic
987928899 5:24377541-24377563 CATCCAGAGGATGCTTTTCTGGG + Intergenic
989195721 5:38714344-38714366 TGCCCACAGGGTGGTGTCCTGGG - Intergenic
997642863 5:135460883-135460905 CAGCCCCATGCTGCTGTCCTTGG - Intergenic
1003070290 6:2940019-2940041 CACCCAGTGGATCCTGTACTGGG - Intergenic
1003531451 6:6940515-6940537 CACCCAGTGGATTCTGTACTGGG - Intergenic
1005016772 6:21381987-21382009 CACACACAGGGTGCAGTCCTAGG + Intergenic
1007125641 6:39423434-39423456 AATCCACAGGATTTTGTCCTAGG + Intronic
1013048718 6:106511970-106511992 CACGAACAGGAGGCTTTCCTGGG + Exonic
1013624361 6:111921737-111921759 GATCCAAAGGATGCAGTCCTGGG - Intergenic
1017080913 6:150667543-150667565 AAACCACAGGAGGCTGTCCTTGG - Intronic
1018465559 6:164041185-164041207 CACACACAGGATGATGTCACAGG - Intergenic
1022419964 7:30210954-30210976 TCCCCTCAGGCTGCTGTCCTGGG - Intergenic
1027640037 7:80722053-80722075 CACCCACAGCCTGCAGTCGTAGG - Intergenic
1028501288 7:91521286-91521308 CACCCACTAGATGCTGCCATGGG + Intergenic
1030366945 7:108657184-108657206 CACCCAGTGGATGCTGCACTGGG + Intergenic
1031466546 7:122119261-122119283 CACCCTCAGGATTATGTCCTGGG + Intronic
1032631444 7:133657503-133657525 CACTTACAAAATGCTGTCCTTGG - Intronic
1034336472 7:150326834-150326856 GAAACACAGGCTGCTGTCCTGGG - Intronic
1034343108 7:150370312-150370334 CACCCACAGCCTGCTGCCCTCGG - Intronic
1035850098 8:2910474-2910496 CACACACAGGATGCTGTGGGAGG + Intergenic
1036991840 8:13607092-13607114 CACACACAGGATCCTGTCGGTGG - Intergenic
1041167994 8:55110300-55110322 CAACAACATGATGGTGTCCTTGG + Intronic
1041941650 8:63394745-63394767 CAGCCAGAGGATGATGTACTTGG - Intergenic
1042809997 8:72814016-72814038 CACACACAGGAGCCTGTCATGGG - Intronic
1046606273 8:116375160-116375182 CACCCACTGGATTCTCCCCTTGG - Intergenic
1047621020 8:126608020-126608042 CACACACTGGAGCCTGTCCTGGG - Intergenic
1048548237 8:135406694-135406716 CACCCACAGGAGGCTGCACTAGG + Intergenic
1049217485 8:141414870-141414892 CCCCATCAGGATGCTGCCCTAGG - Intronic
1049312137 8:141938863-141938885 GACTCACAGGCTGCTGCCCTGGG - Intergenic
1056256284 9:84802813-84802835 CACCCTCAGGATACTGTCAACGG - Intronic
1057966762 9:99511908-99511930 CACCCACAGGAGGCGCTCCCCGG - Intergenic
1058626124 9:106934601-106934623 CACCCAGAGGGAGCTGTCCAGGG + Intronic
1058800624 9:108541358-108541380 CACCCACAGGAGGCTGCCTGAGG + Intergenic
1059427608 9:114231018-114231040 GGCCCACAGGAGGCTGGCCTGGG - Intronic
1060591622 9:124820607-124820629 AACCCAGAGGTTGCTTTCCTGGG - Intergenic
1060794295 9:126503964-126503986 CACCACCAGGACGCTGTGCTCGG + Exonic
1061037289 9:128120847-128120869 CACCCACAGGATGTAGCCATGGG + Exonic
1061834274 9:133318450-133318472 CACTCACAGCATGGTGACCTTGG - Intergenic
1062238081 9:135522162-135522184 CACTCACAGCATGGTGACCTTGG - Exonic
1062537024 9:137025546-137025568 CACCCACAGCATGATGTTCCTGG - Intronic
1186490323 X:9967271-9967293 CACCCATGGGAGGCTGTCCCAGG + Intergenic
1187676689 X:21723345-21723367 CACCCACAGGATGCTGTCCTTGG + Intronic
1190760918 X:53437651-53437673 CACCCACACCATCCTTTCCTTGG + Intergenic
1192162768 X:68800953-68800975 CACCCACAAGATGCTATCCAAGG - Intergenic
1196008722 X:110863666-110863688 GACCCAAATGATGGTGTCCTGGG - Intergenic
1197352793 X:125398968-125398990 CTCCCACAGGATGATGTTCTTGG + Intergenic
1198120987 X:133592291-133592313 CACACACAGGGGCCTGTCCTGGG - Intronic
1202371806 Y:24203799-24203821 AACCCACTGGATGGTTTCCTAGG + Intergenic
1202498979 Y:25466317-25466339 AACCCACTGGATGGTTTCCTAGG - Intergenic