ID: 1187685508 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:21811929-21811951 |
| Sequence | AAGCCACTAGATTTTTAGAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1187685508_1187685512 | 25 | Left | 1187685508 | X:21811929-21811951 | CCATTCTAAAAATCTAGTGGCTT | No data | ||
| Right | 1187685512 | X:21811977-21811999 | CACCAGTTCCTTGGTTGACTGGG | No data | ||||
| 1187685508_1187685511 | 24 | Left | 1187685508 | X:21811929-21811951 | CCATTCTAAAAATCTAGTGGCTT | No data | ||
| Right | 1187685511 | X:21811976-21811998 | TCACCAGTTCCTTGGTTGACTGG | No data | ||||
| 1187685508_1187685510 | 16 | Left | 1187685508 | X:21811929-21811951 | CCATTCTAAAAATCTAGTGGCTT | No data | ||
| Right | 1187685510 | X:21811968-21811990 | ATTTTCTTTCACCAGTTCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1187685508 | Original CRISPR | AAGCCACTAGATTTTTAGAA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||