ID: 1187685509

View in Genome Browser
Species Human (GRCh38)
Location X:21811961-21811983
Sequence ACTGGTGAAAGAAAATGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187685509_1187685516 3 Left 1187685509 X:21811961-21811983 CCATTTCATTTTCTTTCACCAGT No data
Right 1187685516 X:21811987-21812009 TTGGTTGACTGGGCTCAGCTGGG No data
1187685509_1187685517 6 Left 1187685509 X:21811961-21811983 CCATTTCATTTTCTTTCACCAGT No data
Right 1187685517 X:21811990-21812012 GTTGACTGGGCTCAGCTGGGTGG No data
1187685509_1187685515 2 Left 1187685509 X:21811961-21811983 CCATTTCATTTTCTTTCACCAGT No data
Right 1187685515 X:21811986-21812008 CTTGGTTGACTGGGCTCAGCTGG No data
1187685509_1187685512 -7 Left 1187685509 X:21811961-21811983 CCATTTCATTTTCTTTCACCAGT No data
Right 1187685512 X:21811977-21811999 CACCAGTTCCTTGGTTGACTGGG No data
1187685509_1187685511 -8 Left 1187685509 X:21811961-21811983 CCATTTCATTTTCTTTCACCAGT No data
Right 1187685511 X:21811976-21811998 TCACCAGTTCCTTGGTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187685509 Original CRISPR ACTGGTGAAAGAAAATGAAA TGG (reversed) Intergenic