ID: 1187685510

View in Genome Browser
Species Human (GRCh38)
Location X:21811968-21811990
Sequence ATTTTCTTTCACCAGTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187685508_1187685510 16 Left 1187685508 X:21811929-21811951 CCATTCTAAAAATCTAGTGGCTT No data
Right 1187685510 X:21811968-21811990 ATTTTCTTTCACCAGTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187685510 Original CRISPR ATTTTCTTTCACCAGTTCCT TGG Intergenic
No off target data available for this crispr