ID: 1187685512

View in Genome Browser
Species Human (GRCh38)
Location X:21811977-21811999
Sequence CACCAGTTCCTTGGTTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187685509_1187685512 -7 Left 1187685509 X:21811961-21811983 CCATTTCATTTTCTTTCACCAGT No data
Right 1187685512 X:21811977-21811999 CACCAGTTCCTTGGTTGACTGGG No data
1187685508_1187685512 25 Left 1187685508 X:21811929-21811951 CCATTCTAAAAATCTAGTGGCTT No data
Right 1187685512 X:21811977-21811999 CACCAGTTCCTTGGTTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187685512 Original CRISPR CACCAGTTCCTTGGTTGACT GGG Intergenic