ID: 1187685753

View in Genome Browser
Species Human (GRCh38)
Location X:21814142-21814164
Sequence ACTAGCTGCCCCTGGGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187685753_1187685760 17 Left 1187685753 X:21814142-21814164 CCTACACCCCAGGGGCAGCTAGT No data
Right 1187685760 X:21814182-21814204 AGCAGCTAGTTAACATTCCAGGG No data
1187685753_1187685759 16 Left 1187685753 X:21814142-21814164 CCTACACCCCAGGGGCAGCTAGT No data
Right 1187685759 X:21814181-21814203 TAGCAGCTAGTTAACATTCCAGG No data
1187685753_1187685758 -10 Left 1187685753 X:21814142-21814164 CCTACACCCCAGGGGCAGCTAGT No data
Right 1187685758 X:21814155-21814177 GGCAGCTAGTTAACATTGAAGGG No data
1187685753_1187685761 20 Left 1187685753 X:21814142-21814164 CCTACACCCCAGGGGCAGCTAGT No data
Right 1187685761 X:21814185-21814207 AGCTAGTTAACATTCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187685753 Original CRISPR ACTAGCTGCCCCTGGGGTGT AGG (reversed) Intergenic
No off target data available for this crispr