ID: 1187698168

View in Genome Browser
Species Human (GRCh38)
Location X:21941122-21941144
Sequence GGCGCGGCCGGCGGGCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 354}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698168_1187698176 -6 Left 1187698168 X:21941122-21941144 CCCGGGTGCCCGCCGGCCGCGCC 0: 1
1: 0
2: 1
3: 43
4: 354
Right 1187698176 X:21941139-21941161 CGCGCCGCCCTTCCGGGCCCTGG 0: 1
1: 0
2: 3
3: 18
4: 204
1187698168_1187698184 18 Left 1187698168 X:21941122-21941144 CCCGGGTGCCCGCCGGCCGCGCC 0: 1
1: 0
2: 1
3: 43
4: 354
Right 1187698184 X:21941163-21941185 CGTCCACCCGCGCTCCCACGCGG 0: 1
1: 0
2: 0
3: 9
4: 67
1187698168_1187698185 19 Left 1187698168 X:21941122-21941144 CCCGGGTGCCCGCCGGCCGCGCC 0: 1
1: 0
2: 1
3: 43
4: 354
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698168 Original CRISPR GGCGCGGCCGGCGGGCACCC GGG (reversed) Intronic