ID: 1187698169

View in Genome Browser
Species Human (GRCh38)
Location X:21941123-21941145
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 1, 3: 61, 4: 364}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698169_1187698184 17 Left 1187698169 X:21941123-21941145 CCGGGTGCCCGCCGGCCGCGCCG 0: 1
1: 0
2: 1
3: 61
4: 364
Right 1187698184 X:21941163-21941185 CGTCCACCCGCGCTCCCACGCGG 0: 1
1: 0
2: 0
3: 9
4: 67
1187698169_1187698185 18 Left 1187698169 X:21941123-21941145 CCGGGTGCCCGCCGGCCGCGCCG 0: 1
1: 0
2: 1
3: 61
4: 364
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698169_1187698176 -7 Left 1187698169 X:21941123-21941145 CCGGGTGCCCGCCGGCCGCGCCG 0: 1
1: 0
2: 1
3: 61
4: 364
Right 1187698176 X:21941139-21941161 CGCGCCGCCCTTCCGGGCCCTGG 0: 1
1: 0
2: 3
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698169 Original CRISPR CGGCGCGGCCGGCGGGCACC CGG (reversed) Intronic