ID: 1187698171

View in Genome Browser
Species Human (GRCh38)
Location X:21941131-21941153
Sequence CGGAAGGGCGGCGCGGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698171_1187698185 10 Left 1187698171 X:21941131-21941153 CCGCCGGCCGCGCCGCCCTTCCG 0: 1
1: 0
2: 2
3: 40
4: 288
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698171_1187698184 9 Left 1187698171 X:21941131-21941153 CCGCCGGCCGCGCCGCCCTTCCG 0: 1
1: 0
2: 2
3: 40
4: 288
Right 1187698184 X:21941163-21941185 CGTCCACCCGCGCTCCCACGCGG 0: 1
1: 0
2: 0
3: 9
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698171 Original CRISPR CGGAAGGGCGGCGCGGCCGG CGG (reversed) Intronic