ID: 1187698175

View in Genome Browser
Species Human (GRCh38)
Location X:21941138-21941160
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 387}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698175_1187698193 30 Left 1187698175 X:21941138-21941160 CCGCGCCGCCCTTCCGGGCCCTG 0: 1
1: 0
2: 3
3: 37
4: 387
Right 1187698193 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1187698175_1187698191 29 Left 1187698175 X:21941138-21941160 CCGCGCCGCCCTTCCGGGCCCTG 0: 1
1: 0
2: 3
3: 37
4: 387
Right 1187698191 X:21941190-21941212 GCCGCCTTCGCGCTCCCGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 75
1187698175_1187698185 3 Left 1187698175 X:21941138-21941160 CCGCGCCGCCCTTCCGGGCCCTG 0: 1
1: 0
2: 3
3: 37
4: 387
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698175_1187698184 2 Left 1187698175 X:21941138-21941160 CCGCGCCGCCCTTCCGGGCCCTG 0: 1
1: 0
2: 3
3: 37
4: 387
Right 1187698184 X:21941163-21941185 CGTCCACCCGCGCTCCCACGCGG 0: 1
1: 0
2: 0
3: 9
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698175 Original CRISPR CAGGGCCCGGAAGGGCGGCG CGG (reversed) Intronic