ID: 1187698178

View in Genome Browser
Species Human (GRCh38)
Location X:21941146-21941168
Sequence TGGACGGCCAGGGCCCGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698178_1187698191 21 Left 1187698178 X:21941146-21941168 CCCTTCCGGGCCCTGGCCGTCCA 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1187698191 X:21941190-21941212 GCCGCCTTCGCGCTCCCGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 75
1187698178_1187698193 22 Left 1187698178 X:21941146-21941168 CCCTTCCGGGCCCTGGCCGTCCA 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1187698193 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1187698178_1187698185 -5 Left 1187698178 X:21941146-21941168 CCCTTCCGGGCCCTGGCCGTCCA 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698178_1187698194 23 Left 1187698178 X:21941146-21941168 CCCTTCCGGGCCCTGGCCGTCCA 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698178_1187698184 -6 Left 1187698178 X:21941146-21941168 CCCTTCCGGGCCCTGGCCGTCCA 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1187698184 X:21941163-21941185 CGTCCACCCGCGCTCCCACGCGG 0: 1
1: 0
2: 0
3: 9
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698178 Original CRISPR TGGACGGCCAGGGCCCGGAA GGG (reversed) Intronic