ID: 1187698179

View in Genome Browser
Species Human (GRCh38)
Location X:21941147-21941169
Sequence GTGGACGGCCAGGGCCCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698179_1187698193 21 Left 1187698179 X:21941147-21941169 CCTTCCGGGCCCTGGCCGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1187698193 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1187698179_1187698184 -7 Left 1187698179 X:21941147-21941169 CCTTCCGGGCCCTGGCCGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1187698184 X:21941163-21941185 CGTCCACCCGCGCTCCCACGCGG 0: 1
1: 0
2: 0
3: 9
4: 67
1187698179_1187698194 22 Left 1187698179 X:21941147-21941169 CCTTCCGGGCCCTGGCCGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698179_1187698185 -6 Left 1187698179 X:21941147-21941169 CCTTCCGGGCCCTGGCCGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698179_1187698191 20 Left 1187698179 X:21941147-21941169 CCTTCCGGGCCCTGGCCGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1187698191 X:21941190-21941212 GCCGCCTTCGCGCTCCCGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698179 Original CRISPR GTGGACGGCCAGGGCCCGGA AGG (reversed) Intronic