ID: 1187698180

View in Genome Browser
Species Human (GRCh38)
Location X:21941151-21941173
Sequence GCGGGTGGACGGCCAGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 497}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698180_1187698197 28 Left 1187698180 X:21941151-21941173 CCGGGCCCTGGCCGTCCACCCGC 0: 1
1: 0
2: 1
3: 35
4: 497
Right 1187698197 X:21941202-21941224 CTCCCGCTCGGGGAGTCCCCGGG 0: 1
1: 0
2: 0
3: 18
4: 123
1187698180_1187698196 27 Left 1187698180 X:21941151-21941173 CCGGGCCCTGGCCGTCCACCCGC 0: 1
1: 0
2: 1
3: 35
4: 497
Right 1187698196 X:21941201-21941223 GCTCCCGCTCGGGGAGTCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 122
1187698180_1187698193 17 Left 1187698180 X:21941151-21941173 CCGGGCCCTGGCCGTCCACCCGC 0: 1
1: 0
2: 1
3: 35
4: 497
Right 1187698193 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1187698180_1187698194 18 Left 1187698180 X:21941151-21941173 CCGGGCCCTGGCCGTCCACCCGC 0: 1
1: 0
2: 1
3: 35
4: 497
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698180_1187698191 16 Left 1187698180 X:21941151-21941173 CCGGGCCCTGGCCGTCCACCCGC 0: 1
1: 0
2: 1
3: 35
4: 497
Right 1187698191 X:21941190-21941212 GCCGCCTTCGCGCTCCCGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 75
1187698180_1187698185 -10 Left 1187698180 X:21941151-21941173 CCGGGCCCTGGCCGTCCACCCGC 0: 1
1: 0
2: 1
3: 35
4: 497
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698180 Original CRISPR GCGGGTGGACGGCCAGGGCC CGG (reversed) Intronic